[INFO] fetching crate seq_io 0.4.0-alpha.0... [INFO] checking seq_io-0.4.0-alpha.0 against try#506dff8de9f54f528028a7e4497ea925a4f3e19e for pr-94295 [INFO] extracting crate seq_io 0.4.0-alpha.0 into /workspace/builds/worker-112/source [INFO] validating manifest of crates.io crate seq_io 0.4.0-alpha.0 on toolchain 506dff8de9f54f528028a7e4497ea925a4f3e19e [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+506dff8de9f54f528028a7e4497ea925a4f3e19e" "metadata" "--manifest-path" "Cargo.toml" "--no-deps", kill_on_drop: false }` [INFO] started tweaking crates.io crate seq_io 0.4.0-alpha.0 [INFO] finished tweaking crates.io crate seq_io 0.4.0-alpha.0 [INFO] tweaked toml for crates.io crate seq_io 0.4.0-alpha.0 written to /workspace/builds/worker-112/source/Cargo.toml [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+506dff8de9f54f528028a7e4497ea925a4f3e19e" "generate-lockfile" "--manifest-path" "Cargo.toml" "-Zno-index-update", kill_on_drop: false }` [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+506dff8de9f54f528028a7e4497ea925a4f3e19e" "fetch" "--manifest-path" "Cargo.toml", kill_on_drop: false }` [INFO] [stderr] Blocking waiting for file lock on package cache [INFO] [stderr] Blocking waiting for file lock on package cache [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-112/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-112/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "ghcr.io/rust-lang/crates-build-env/linux@sha256:0cd99ca24d8e8c98e67c542213511d985b8778b5bdcbb160e038429496686047" "/opt/rustwide/cargo-home/bin/cargo" "+506dff8de9f54f528028a7e4497ea925a4f3e19e" "metadata" "--no-deps" "--format-version=1", kill_on_drop: false }` [INFO] [stdout] 3972b91f82bbb6c543ca7427d480cef54caf8f0cf5449fe81fe2b430b129ac22 [INFO] running `Command { std: "docker" "start" "-a" "3972b91f82bbb6c543ca7427d480cef54caf8f0cf5449fe81fe2b430b129ac22", kill_on_drop: false }` [INFO] running `Command { std: "docker" "inspect" "3972b91f82bbb6c543ca7427d480cef54caf8f0cf5449fe81fe2b430b129ac22", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "3972b91f82bbb6c543ca7427d480cef54caf8f0cf5449fe81fe2b430b129ac22", kill_on_drop: false }` [INFO] [stdout] 3972b91f82bbb6c543ca7427d480cef54caf8f0cf5449fe81fe2b430b129ac22 [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-112/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-112/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "ghcr.io/rust-lang/crates-build-env/linux@sha256:0cd99ca24d8e8c98e67c542213511d985b8778b5bdcbb160e038429496686047" "/opt/rustwide/cargo-home/bin/cargo" "+506dff8de9f54f528028a7e4497ea925a4f3e19e" "check" "--frozen" "--all" "--all-targets" "--message-format=json", kill_on_drop: false }` [INFO] [stdout] 7f6cfc5f26683f094dc4d75d96f892f784bd87a68046b62febb7f52911dad679 [INFO] running `Command { std: "docker" "start" "-a" "7f6cfc5f26683f094dc4d75d96f892f784bd87a68046b62febb7f52911dad679", kill_on_drop: false }` [INFO] [stderr] Compiling syn v1.0.86 [INFO] [stderr] Compiling cc v1.0.73 [INFO] [stderr] Compiling getrandom v0.1.16 [INFO] [stderr] Compiling semver v0.1.20 [INFO] [stderr] Compiling pkg-config v0.3.24 [INFO] [stderr] Compiling unicode-segmentation v1.9.0 [INFO] [stderr] Compiling rustversion v1.0.6 [INFO] [stderr] Checking ppv-lite86 v0.2.16 [INFO] [stderr] Compiling doc-comment v0.3.3 [INFO] [stderr] Checking regex-syntax v0.6.25 [INFO] [stderr] Compiling crc32fast v1.3.2 [INFO] [stderr] Compiling feature-probe v0.1.1 [INFO] [stderr] Compiling crossbeam-queue v0.3.4 [INFO] [stderr] Checking rawpointer v0.2.1 [INFO] [stderr] Checking hashbrown v0.11.2 [INFO] [stderr] Compiling ndarray v0.13.1 [INFO] [stderr] Compiling bio v0.32.0 [INFO] [stderr] Checking bit-vec v0.6.3 [INFO] [stderr] Checking fixedbitset v0.2.0 [INFO] [stderr] Checking array-macro v1.0.5 [INFO] [stderr] Checking safemem v0.3.3 [INFO] [stderr] Checking fnv v1.0.7 [INFO] [stderr] Checking triple_accel v0.3.4 [INFO] [stderr] Checking quick-error v1.2.3 [INFO] [stderr] Checking bytecount v0.6.2 [INFO] [stderr] Checking strum v0.18.0 [INFO] [stderr] Checking scoped_threadpool v0.1.9 [INFO] [stderr] Checking custom_derive v0.1.7 [INFO] [stderr] Compiling indexmap v1.8.0 [INFO] [stderr] Compiling num-integer v0.1.44 [INFO] [stderr] Compiling num-complex v0.2.4 [INFO] [stderr] Checking fxhash v0.2.1 [INFO] [stderr] Checking itertools v0.9.0 [INFO] [stderr] Checking memchr v2.4.1 [INFO] [stderr] Compiling rustc_version v0.1.7 [INFO] [stderr] Checking matrixmultiply v0.2.4 [INFO] [stderr] Checking ordered-float v1.1.1 [INFO] [stderr] Checking approx v0.3.2 [INFO] [stderr] Checking itertools-num v0.1.3 [INFO] [stderr] Checking bit-set v0.5.2 [INFO] [stderr] Compiling bv v0.11.1 [INFO] [stderr] Compiling heck v0.3.3 [INFO] [stderr] Checking aho-corasick v0.7.18 [INFO] [stderr] Checking csv-core v0.1.10 [INFO] [stderr] Checking buf_redux v0.8.4 [INFO] [stderr] Checking rand_core v0.5.1 [INFO] [stderr] Compiling newtype_derive v0.1.6 [INFO] [stderr] Compiling libz-sys v1.1.3 [INFO] [stderr] Compiling lz4-sys v1.9.2 [INFO] [stderr] Checking crossbeam v0.8.1 [INFO] [stderr] Checking rand_chacha v0.2.2 [INFO] [stderr] Checking rand_isaac v0.2.0 [INFO] [stderr] Checking flate2 v1.0.22 [INFO] [stderr] Checking rand v0.7.3 [INFO] [stderr] Checking petgraph v0.5.1 [INFO] [stderr] Checking regex v1.5.4 [INFO] [stderr] Checking statrs v0.12.0 [INFO] [stderr] Checking rand_distr v0.2.2 [INFO] [stderr] Compiling serde_derive v1.0.136 [INFO] [stderr] Compiling thiserror-impl v1.0.30 [INFO] [stderr] Compiling derive-new v0.5.9 [INFO] [stderr] Compiling snafu-derive v0.6.10 [INFO] [stderr] Compiling enum-map-derive v0.4.6 [INFO] [stderr] Compiling strum_macros v0.23.1 [INFO] [stderr] Compiling getset v0.0.9 [INFO] [stderr] Compiling strum_macros v0.18.0 [INFO] [stderr] Checking enum-map v0.6.6 [INFO] [stderr] Checking thiserror v1.0.30 [INFO] [stderr] Checking bio-types v0.12.1 [INFO] [stderr] Checking snafu v0.6.10 [INFO] [stderr] Checking serde v1.0.136 [INFO] [stderr] Checking bstr v0.2.17 [INFO] [stderr] Checking serde_json v1.0.79 [INFO] [stderr] Checking multimap v0.8.3 [INFO] [stderr] Checking vec_map v0.8.2 [INFO] [stderr] Checking serde_cbor v0.11.2 [INFO] [stderr] Checking seq_io v0.4.0-alpha.0 (/opt/rustwide/workdir) [INFO] [stderr] Checking csv v1.1.6 [INFO] [stderr] Checking tinytemplate v1.2.1 [INFO] [stderr] Checking criterion v0.3.5 [INFO] [stderr] Checking lz4 v1.23.2 [INFO] [stderr] Checking fastq v0.6.0 [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fasta.rs:16:5 [INFO] [stdout] | [INFO] [stdout] 16 | / impl_fasta_standard_tests!( [INFO] [stdout] 17 | | Reader, [INFO] [stdout] 18 | | LineStore, [INFO] [stdout] 19 | | RecordSet, [INFO] [stdout] 20 | | ErrorKind, [INFO] [stdout] 21 | | seq_io::parallel::read_process_fasta_records [INFO] [stdout] 22 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(array_into_iter)]` on by default [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fasta.rs:30:5 [INFO] [stdout] | [INFO] [stdout] 30 | / impl_fasta_single_tests!( [INFO] [stdout] 31 | | Reader, [INFO] [stdout] 32 | | LineStore, [INFO] [stdout] 33 | | RecordSet, [INFO] [stdout] 34 | | ErrorKind, [INFO] [stdout] 35 | | seq_io::parallel::read_process_fasta_records [INFO] [stdout] 36 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: 2 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastq.rs:25:5 [INFO] [stdout] | [INFO] [stdout] 25 | / impl_fastq_standard_tests!( [INFO] [stdout] 26 | | Reader, [INFO] [stdout] 27 | | RangeStore, [INFO] [stdout] 28 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 31 | | seq_io::parallel::read_process_fastq_records [INFO] [stdout] 32 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(array_into_iter)]` on by default [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastq.rs:39:5 [INFO] [stdout] | [INFO] [stdout] 39 | / impl_fastq_multi_tests!( [INFO] [stdout] 40 | | Reader, [INFO] [stdout] 41 | | MultiRangeStore, [INFO] [stdout] 42 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 45 | | seq_io::parallel::read_process_fastq_records [INFO] [stdout] 46 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: 2 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: constant is never used: `FASTA_SINGLE` [INFO] [stdout] --> tests/fasta_common/seq.rs:116:1 [INFO] [stdout] | [INFO] [stdout] 116 | / pub const FASTA_SINGLE: &[u8] = b" [INFO] [stdout] 117 | | [INFO] [stdout] 118 | | >id desc [INFO] [stdout] 119 | | ACCGTAGGCTCCGTAGGCTG\r [INFO] [stdout] ... | [INFO] [stdout] 126 | | [INFO] [stdout] 127 | | "; [INFO] [stdout] | |__^ [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(dead_code)]` on by default [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:19:5 [INFO] [stdout] | [INFO] [stdout] 19 | / impl_fasta_standard_tests!( [INFO] [stdout] 20 | | Reader, [INFO] [stdout] 21 | | seq_io::fasta::LineStore, [INFO] [stdout] 22 | | RecordSet, [INFO] [stdout] 23 | | ErrorKind, [INFO] [stdout] 24 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 25 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(array_into_iter)]` on by default [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:32:5 [INFO] [stdout] | [INFO] [stdout] 32 | / impl_fasta_standard_tests!( [INFO] [stdout] 33 | | Reader, [INFO] [stdout] 34 | | LineStore, [INFO] [stdout] 35 | | RecordSet, [INFO] [stdout] 36 | | ErrorKind, [INFO] [stdout] 37 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 38 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:54:5 [INFO] [stdout] | [INFO] [stdout] 54 | / impl_fastq_standard_tests!( [INFO] [stdout] 55 | | Reader, [INFO] [stdout] 56 | | seq_io::fastq::RangeStore, [INFO] [stdout] 57 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 60 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 61 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:67:5 [INFO] [stdout] | [INFO] [stdout] 67 | / impl_fastq_standard_tests!( [INFO] [stdout] 68 | | Reader, [INFO] [stdout] 69 | | seq_io::fastq::RangeStore, [INFO] [stdout] 70 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 73 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 74 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:80:5 [INFO] [stdout] | [INFO] [stdout] 80 | / impl_fastq_standard_tests!( [INFO] [stdout] 81 | | Reader, [INFO] [stdout] 82 | | seq_io::fastx::LineStore, [INFO] [stdout] 83 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 86 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 87 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:94:5 [INFO] [stdout] | [INFO] [stdout] 94 | / impl_fastq_multi_tests!( [INFO] [stdout] 95 | | Reader, [INFO] [stdout] 96 | | LineStore, [INFO] [stdout] 97 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 100 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 101 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: 7 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 50.75s [INFO] running `Command { std: "docker" "inspect" "7f6cfc5f26683f094dc4d75d96f892f784bd87a68046b62febb7f52911dad679", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "7f6cfc5f26683f094dc4d75d96f892f784bd87a68046b62febb7f52911dad679", kill_on_drop: false }` [INFO] [stdout] 7f6cfc5f26683f094dc4d75d96f892f784bd87a68046b62febb7f52911dad679