[INFO] fetching crate seq_io 0.4.0-alpha.0... [INFO] testing seq_io-0.4.0-alpha.0 against try#722e1797249a965b6335aebd65d777f917e498f1 for pr-91031 [INFO] extracting crate seq_io 0.4.0-alpha.0 into /workspace/builds/worker-8/source [INFO] validating manifest of crates.io crate seq_io 0.4.0-alpha.0 on toolchain 722e1797249a965b6335aebd65d777f917e498f1 [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "metadata" "--manifest-path" "Cargo.toml" "--no-deps", kill_on_drop: false }` [INFO] started tweaking crates.io crate seq_io 0.4.0-alpha.0 [INFO] finished tweaking crates.io crate seq_io 0.4.0-alpha.0 [INFO] tweaked toml for crates.io crate seq_io 0.4.0-alpha.0 written to /workspace/builds/worker-8/source/Cargo.toml [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "generate-lockfile" "--manifest-path" "Cargo.toml" "-Zno-index-update", kill_on_drop: false }` [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "fetch" "--manifest-path" "Cargo.toml", kill_on_drop: false }` [INFO] [stderr] Downloading crates ... [INFO] [stderr] Downloaded strum_macros v0.23.0 [INFO] [stderr] Downloaded array-macro v1.0.5 [INFO] [stderr] Downloaded enum-map-derive v0.4.6 [INFO] [stderr] Downloaded bio-types v0.12.1 [INFO] [stderr] Downloaded enum-map v0.6.4 [INFO] [stderr] Downloaded getset v0.0.9 [INFO] [stderr] Downloaded bio v0.32.0 [INFO] [stderr] Downloaded rand_isaac v0.2.0 [INFO] [stderr] Downloaded triple_accel v0.3.4 [INFO] [stderr] Downloaded fastq v0.6.0 [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "ghcr.io/rust-lang/crates-build-env/linux@sha256:5736fa189c1c60b01babf4b8b698fe57b6ecc41933a7ff2e0b8d7a221459412b" "/opt/rustwide/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "metadata" "--no-deps" "--format-version=1", kill_on_drop: false }` [INFO] [stdout] 09047156bd07bff04c562474279a28862cd43d6b51b378eff44ae53c370259c6 [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] running `Command { std: "docker" "start" "-a" "09047156bd07bff04c562474279a28862cd43d6b51b378eff44ae53c370259c6", kill_on_drop: false }` [INFO] running `Command { std: "docker" "inspect" "09047156bd07bff04c562474279a28862cd43d6b51b378eff44ae53c370259c6", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "09047156bd07bff04c562474279a28862cd43d6b51b378eff44ae53c370259c6", kill_on_drop: false }` [INFO] [stdout] 09047156bd07bff04c562474279a28862cd43d6b51b378eff44ae53c370259c6 [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "ghcr.io/rust-lang/crates-build-env/linux@sha256:5736fa189c1c60b01babf4b8b698fe57b6ecc41933a7ff2e0b8d7a221459412b" "/opt/rustwide/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "build" "--frozen" "--message-format=json", kill_on_drop: false }` [INFO] [stdout] a765aa1e9abf3e4134e97d8263bea6bd2b69b5fa56344a2cd1d705ede5b2f103 [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] running `Command { std: "docker" "start" "-a" "a765aa1e9abf3e4134e97d8263bea6bd2b69b5fa56344a2cd1d705ede5b2f103", kill_on_drop: false }` [INFO] [stderr] Compiling proc-macro2 v1.0.32 [INFO] [stderr] Compiling autocfg v1.0.1 [INFO] [stderr] Compiling unicode-xid v0.2.2 [INFO] [stderr] Compiling serde_derive v1.0.130 [INFO] [stderr] Compiling crossbeam-utils v0.8.5 [INFO] [stderr] Compiling buf_redux v0.8.4 [INFO] [stderr] Compiling crossbeam-queue v0.3.2 [INFO] [stderr] Compiling crossbeam-channel v0.5.1 [INFO] [stderr] Compiling memoffset v0.6.4 [INFO] [stderr] Compiling quote v1.0.10 [INFO] [stderr] Compiling crossbeam-epoch v0.9.5 [INFO] [stderr] Compiling crossbeam-deque v0.8.1 [INFO] [stderr] Compiling syn v1.0.81 [INFO] [stderr] Compiling crossbeam v0.8.1 [INFO] [stderr] Compiling serde v1.0.130 [INFO] [stderr] Compiling seq_io v0.4.0-alpha.0 (/opt/rustwide/workdir) [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 38.27s [INFO] running `Command { std: "docker" "inspect" "a765aa1e9abf3e4134e97d8263bea6bd2b69b5fa56344a2cd1d705ede5b2f103", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "a765aa1e9abf3e4134e97d8263bea6bd2b69b5fa56344a2cd1d705ede5b2f103", kill_on_drop: false }` [INFO] [stdout] a765aa1e9abf3e4134e97d8263bea6bd2b69b5fa56344a2cd1d705ede5b2f103 [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "ghcr.io/rust-lang/crates-build-env/linux@sha256:5736fa189c1c60b01babf4b8b698fe57b6ecc41933a7ff2e0b8d7a221459412b" "/opt/rustwide/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "test" "--frozen" "--no-run" "--message-format=json", kill_on_drop: false }` [INFO] [stdout] 5b807d007714e670651d5f73bee9d74bdd5afe64029a81ec817ba8ccc237a4cc [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] running `Command { std: "docker" "start" "-a" "5b807d007714e670651d5f73bee9d74bdd5afe64029a81ec817ba8ccc237a4cc", kill_on_drop: false }` [INFO] [stderr] Compiling cc v1.0.72 [INFO] [stderr] Compiling semver v1.0.4 [INFO] [stderr] Compiling ryu v1.0.5 [INFO] [stderr] Compiling either v1.6.1 [INFO] [stderr] Compiling itoa v0.4.8 [INFO] [stderr] Compiling rustversion v1.0.5 [INFO] [stderr] Compiling semver v0.1.20 [INFO] [stderr] Compiling serde_json v1.0.71 [INFO] [stderr] Compiling doc-comment v0.3.3 [INFO] [stderr] Compiling crc32fast v1.2.1 [INFO] [stderr] Compiling plotters-backend v0.3.2 [INFO] [stderr] Compiling half v1.8.2 [INFO] [stderr] Compiling fixedbitset v0.2.0 [INFO] [stderr] Compiling array-macro v1.0.5 [INFO] [stderr] Compiling bio v0.32.0 [INFO] [stderr] Compiling bit-vec v0.6.3 [INFO] [stderr] Compiling byteorder v1.4.3 [INFO] [stderr] Compiling bytecount v0.6.2 [INFO] [stderr] Compiling triple_accel v0.3.4 [INFO] [stderr] Compiling strum v0.18.0 [INFO] [stderr] Compiling fnv v1.0.7 [INFO] [stderr] Compiling custom_derive v0.1.7 [INFO] [stderr] Compiling num-traits v0.2.14 [INFO] [stderr] Compiling num-complex v0.2.4 [INFO] [stderr] Compiling indexmap v1.7.0 [INFO] [stderr] Compiling num-integer v0.1.44 [INFO] [stderr] Compiling rayon v1.5.1 [INFO] [stderr] Compiling itertools v0.10.1 [INFO] [stderr] Compiling itertools v0.9.0 [INFO] [stderr] Compiling rustc_version v0.1.7 [INFO] [stderr] Compiling plotters-svg v0.3.1 [INFO] [stderr] Compiling bit-set v0.5.2 [INFO] [stderr] Compiling fxhash v0.2.1 [INFO] [stderr] Compiling clap v2.33.3 [INFO] [stderr] Compiling getrandom v0.1.16 [INFO] [stderr] Compiling csv-core v0.1.10 [INFO] [stderr] Compiling thiserror-impl v1.0.30 [INFO] [stderr] Compiling snafu-derive v0.6.10 [INFO] [stderr] Compiling enum-map-derive v0.4.6 [INFO] [stderr] Compiling derive-new v0.5.9 [INFO] [stderr] Compiling strum_macros v0.18.0 [INFO] [stderr] Compiling getset v0.0.9 [INFO] [stderr] Compiling rand_core v0.5.1 [INFO] [stderr] Compiling newtype_derive v0.1.6 [INFO] [stderr] Compiling rayon-core v1.9.1 [INFO] [stderr] Compiling rustc_version v0.4.0 [INFO] [stderr] Compiling rand_chacha v0.2.2 [INFO] [stderr] Compiling rand_isaac v0.2.0 [INFO] [stderr] Compiling bstr v0.2.17 [INFO] [stderr] Compiling serde_cbor v0.11.2 [INFO] [stderr] Compiling multimap v0.8.3 [INFO] [stderr] Compiling vec_map v0.8.2 [INFO] [stderr] Compiling bv v0.11.1 [INFO] [stderr] Compiling rand v0.7.3 [INFO] [stderr] Compiling libz-sys v1.1.3 [INFO] [stderr] Compiling lz4-sys v1.9.2 [INFO] [stderr] Compiling strum_macros v0.23.0 [INFO] [stderr] Compiling petgraph v0.5.1 [INFO] [stderr] Compiling itertools-num v0.1.3 [INFO] [stderr] Compiling approx v0.3.2 [INFO] [stderr] Compiling ordered-float v1.1.1 [INFO] [stderr] Compiling plotters v0.3.1 [INFO] [stderr] Compiling cast v0.2.7 [INFO] [stderr] Compiling enum-map v0.6.4 [INFO] [stderr] Compiling csv v1.1.6 [INFO] [stderr] Compiling tinytemplate v1.2.1 [INFO] [stderr] Compiling statrs v0.12.0 [INFO] [stderr] Compiling rand_distr v0.2.2 [INFO] [stderr] Compiling ndarray v0.13.1 [INFO] [stderr] Compiling flate2 v1.0.22 [INFO] [stderr] Compiling criterion-plot v0.4.4 [INFO] [stderr] Compiling thiserror v1.0.30 [INFO] [stderr] Compiling snafu v0.6.10 [INFO] [stderr] Compiling criterion v0.3.5 [INFO] [stderr] Compiling bio-types v0.12.1 [INFO] [stderr] Compiling lz4 v1.23.2 [INFO] [stderr] Compiling fastq v0.6.0 [INFO] [stderr] Compiling seq_io v0.4.0-alpha.0 (/opt/rustwide/workdir) [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fasta.rs:16:5 [INFO] [stdout] | [INFO] [stdout] 16 | / impl_fasta_standard_tests!( [INFO] [stdout] 17 | | Reader, [INFO] [stdout] 18 | | LineStore, [INFO] [stdout] 19 | | RecordSet, [INFO] [stdout] 20 | | ErrorKind, [INFO] [stdout] 21 | | seq_io::parallel::read_process_fasta_records [INFO] [stdout] 22 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(array_into_iter)]` on by default [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fasta.rs:30:5 [INFO] [stdout] | [INFO] [stdout] 30 | / impl_fasta_single_tests!( [INFO] [stdout] 31 | | Reader, [INFO] [stdout] 32 | | LineStore, [INFO] [stdout] 33 | | RecordSet, [INFO] [stdout] 34 | | ErrorKind, [INFO] [stdout] 35 | | seq_io::parallel::read_process_fasta_records [INFO] [stdout] 36 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastq.rs:25:5 [INFO] [stdout] | [INFO] [stdout] 25 | / impl_fastq_standard_tests!( [INFO] [stdout] 26 | | Reader, [INFO] [stdout] 27 | | RangeStore, [INFO] [stdout] 28 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 31 | | seq_io::parallel::read_process_fastq_records [INFO] [stdout] 32 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(array_into_iter)]` on by default [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastq.rs:39:5 [INFO] [stdout] | [INFO] [stdout] 39 | / impl_fastq_multi_tests!( [INFO] [stdout] 40 | | Reader, [INFO] [stdout] 41 | | MultiRangeStore, [INFO] [stdout] 42 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 45 | | seq_io::parallel::read_process_fastq_records [INFO] [stdout] 46 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: constant is never used: `FASTA_SINGLE` [INFO] [stdout] --> tests/fasta_common/seq.rs:116:1 [INFO] [stdout] | [INFO] [stdout] 116 | / pub const FASTA_SINGLE: &[u8] = b" [INFO] [stdout] 117 | | [INFO] [stdout] 118 | | >id desc [INFO] [stdout] 119 | | ACCGTAGGCTCCGTAGGCTG\r [INFO] [stdout] ... | [INFO] [stdout] 126 | | [INFO] [stdout] 127 | | "; [INFO] [stdout] | |__^ [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(dead_code)]` on by default [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:19:5 [INFO] [stdout] | [INFO] [stdout] 19 | / impl_fasta_standard_tests!( [INFO] [stdout] 20 | | Reader, [INFO] [stdout] 21 | | seq_io::fasta::LineStore, [INFO] [stdout] 22 | | RecordSet, [INFO] [stdout] 23 | | ErrorKind, [INFO] [stdout] 24 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 25 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(array_into_iter)]` on by default [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:32:5 [INFO] [stdout] | [INFO] [stdout] 32 | / impl_fasta_standard_tests!( [INFO] [stdout] 33 | | Reader, [INFO] [stdout] 34 | | LineStore, [INFO] [stdout] 35 | | RecordSet, [INFO] [stdout] 36 | | ErrorKind, [INFO] [stdout] 37 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 38 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:54:5 [INFO] [stdout] | [INFO] [stdout] 54 | / impl_fastq_standard_tests!( [INFO] [stdout] 55 | | Reader, [INFO] [stdout] 56 | | seq_io::fastq::RangeStore, [INFO] [stdout] 57 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 60 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 61 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:67:5 [INFO] [stdout] | [INFO] [stdout] 67 | / impl_fastq_standard_tests!( [INFO] [stdout] 68 | | Reader, [INFO] [stdout] 69 | | seq_io::fastq::RangeStore, [INFO] [stdout] 70 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 73 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 74 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:80:5 [INFO] [stdout] | [INFO] [stdout] 80 | / impl_fastq_standard_tests!( [INFO] [stdout] 81 | | Reader, [INFO] [stdout] 82 | | seq_io::fastx::LineStore, [INFO] [stdout] 83 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 86 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 87 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stdout] --> tests/common.rs:72:38 [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.into_iter() { [INFO] [stdout] | ^^^^^^^^^ [INFO] [stdout] | [INFO] [stdout] ::: tests/fastx.rs:94:5 [INFO] [stdout] | [INFO] [stdout] 94 | / impl_fastq_multi_tests!( [INFO] [stdout] 95 | | Reader, [INFO] [stdout] 96 | | LineStore, [INFO] [stdout] 97 | | RecordSet, [INFO] [stdout] ... | [INFO] [stdout] 100 | | seq_io::parallel::read_process_fastx_records [INFO] [stdout] 101 | | ); [INFO] [stdout] | |_____- in this macro invocation [INFO] [stdout] | [INFO] [stdout] = warning: this changes meaning in Rust 2021 [INFO] [stdout] = note: for more information, see [INFO] [stdout] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stdout] | [INFO] [stdout] 72 | for exp in $expected.iter() { [INFO] [stdout] | ~~~~ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: 2 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: 2 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: 7 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stderr] Finished test [unoptimized + debuginfo] target(s) in 1m 51s [INFO] running `Command { std: "docker" "inspect" "5b807d007714e670651d5f73bee9d74bdd5afe64029a81ec817ba8ccc237a4cc", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "5b807d007714e670651d5f73bee9d74bdd5afe64029a81ec817ba8ccc237a4cc", kill_on_drop: false }` [INFO] [stdout] 5b807d007714e670651d5f73bee9d74bdd5afe64029a81ec817ba8ccc237a4cc [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "ghcr.io/rust-lang/crates-build-env/linux@sha256:5736fa189c1c60b01babf4b8b698fe57b6ecc41933a7ff2e0b8d7a221459412b" "/opt/rustwide/cargo-home/bin/cargo" "+722e1797249a965b6335aebd65d777f917e498f1" "test" "--frozen", kill_on_drop: false }` [INFO] [stdout] 445cd766919bb5c23d395d4a51d8e27ef5304e3df212370ac40fef93bbcabded [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] running `Command { std: "docker" "start" "-a" "445cd766919bb5c23d395d4a51d8e27ef5304e3df212370ac40fef93bbcabded", kill_on_drop: false }` [INFO] [stderr] warning: constant is never used: `FASTA_SINGLE` [INFO] [stderr] --> tests/fasta_common/seq.rs:116:1 [INFO] [stderr] | [INFO] [stderr] 116 | / pub const FASTA_SINGLE: &[u8] = b" [INFO] [stderr] 117 | | [INFO] [stderr] 118 | | >id desc [INFO] [stderr] 119 | | ACCGTAGGCTCCGTAGGCTG\r [INFO] [stderr] ... | [INFO] [stderr] 126 | | [INFO] [stderr] 127 | | "; [INFO] [stderr] | |__^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(dead_code)]` on by default [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastx.rs:19:5 [INFO] [stderr] | [INFO] [stderr] 19 | / impl_fasta_standard_tests!( [INFO] [stderr] 20 | | Reader, [INFO] [stderr] 21 | | seq_io::fasta::LineStore, [INFO] [stderr] 22 | | RecordSet, [INFO] [stderr] 23 | | ErrorKind, [INFO] [stderr] 24 | | seq_io::parallel::read_process_fastx_records [INFO] [stderr] 25 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(array_into_iter)]` on by default [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastx.rs:32:5 [INFO] [stderr] | [INFO] [stderr] 32 | / impl_fasta_standard_tests!( [INFO] [stderr] 33 | | Reader, [INFO] [stderr] 34 | | LineStore, [INFO] [stderr] 35 | | RecordSet, [INFO] [stderr] 36 | | ErrorKind, [INFO] [stderr] 37 | | seq_io::parallel::read_process_fastx_records [INFO] [stderr] 38 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastx.rs:54:5 [INFO] [stderr] | [INFO] [stderr] 54 | / impl_fastq_standard_tests!( [INFO] [stderr] 55 | | Reader, [INFO] [stderr] 56 | | seq_io::fastq::RangeStore, [INFO] [stderr] 57 | | RecordSet, [INFO] [stderr] ... | [INFO] [stderr] 60 | | seq_io::parallel::read_process_fastx_records [INFO] [stderr] 61 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastx.rs:67:5 [INFO] [stderr] | [INFO] [stderr] 67 | / impl_fastq_standard_tests!( [INFO] [stderr] 68 | | Reader, [INFO] [stderr] 69 | | seq_io::fastq::RangeStore, [INFO] [stderr] 70 | | RecordSet, [INFO] [stderr] ... | [INFO] [stderr] 73 | | seq_io::parallel::read_process_fastx_records [INFO] [stderr] 74 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastx.rs:80:5 [INFO] [stderr] | [INFO] [stderr] 80 | / impl_fastq_standard_tests!( [INFO] [stderr] 81 | | Reader, [INFO] [stderr] 82 | | seq_io::fastx::LineStore, [INFO] [stderr] 83 | | RecordSet, [INFO] [stderr] ... | [INFO] [stderr] 86 | | seq_io::parallel::read_process_fastx_records [INFO] [stderr] 87 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastx.rs:94:5 [INFO] [stderr] | [INFO] [stderr] 94 | / impl_fastq_multi_tests!( [INFO] [stderr] 95 | | Reader, [INFO] [stderr] 96 | | LineStore, [INFO] [stderr] 97 | | RecordSet, [INFO] [stderr] ... | [INFO] [stderr] 100 | | seq_io::parallel::read_process_fastx_records [INFO] [stderr] 101 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastq.rs:25:5 [INFO] [stderr] | [INFO] [stderr] 25 | / impl_fastq_standard_tests!( [INFO] [stderr] 26 | | Reader, [INFO] [stderr] 27 | | RangeStore, [INFO] [stderr] 28 | | RecordSet, [INFO] [stderr] ... | [INFO] [stderr] 31 | | seq_io::parallel::read_process_fastq_records [INFO] [stderr] 32 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(array_into_iter)]` on by default [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fastq.rs:39:5 [INFO] [stderr] | [INFO] [stderr] 39 | / impl_fastq_multi_tests!( [INFO] [stderr] 40 | | Reader, [INFO] [stderr] 41 | | MultiRangeStore, [INFO] [stderr] 42 | | RecordSet, [INFO] [stderr] ... | [INFO] [stderr] 45 | | seq_io::parallel::read_process_fastq_records [INFO] [stderr] 46 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fasta.rs:16:5 [INFO] [stderr] | [INFO] [stderr] 16 | / impl_fasta_standard_tests!( [INFO] [stderr] 17 | | Reader, [INFO] [stderr] 18 | | LineStore, [INFO] [stderr] 19 | | RecordSet, [INFO] [stderr] 20 | | ErrorKind, [INFO] [stderr] 21 | | seq_io::parallel::read_process_fasta_records [INFO] [stderr] 22 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(array_into_iter)]` on by default [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: this method call resolves to `<&[T; N] as IntoIterator>::into_iter` (due to backwards compatibility), but will resolve to <[T; N] as IntoIterator>::into_iter in Rust 2021 [INFO] [stderr] --> tests/common.rs:72:38 [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.into_iter() { [INFO] [stderr] | ^^^^^^^^^ [INFO] [stderr] | [INFO] [stderr] ::: tests/fasta.rs:30:5 [INFO] [stderr] | [INFO] [stderr] 30 | / impl_fasta_single_tests!( [INFO] [stderr] 31 | | Reader, [INFO] [stderr] 32 | | LineStore, [INFO] [stderr] 33 | | RecordSet, [INFO] [stderr] 34 | | ErrorKind, [INFO] [stderr] 35 | | seq_io::parallel::read_process_fasta_records [INFO] [stderr] 36 | | ); [INFO] [stderr] | |_____- in this macro invocation [INFO] [stderr] | [INFO] [stderr] = warning: this changes meaning in Rust 2021 [INFO] [stderr] = note: for more information, see [INFO] [stderr] = note: this warning originates in the macro `impl_common_tests` (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] help: use `.iter()` instead of `.into_iter()` to avoid ambiguity [INFO] [stderr] | [INFO] [stderr] 72 | for exp in $expected.iter() { [INFO] [stderr] | ~~~~ [INFO] [stderr] [INFO] [stderr] warning: `seq_io` (test "fastx") generated 7 warnings [INFO] [stderr] warning: `seq_io` (test "fastq") generated 2 warnings [INFO] [stderr] warning: `seq_io` (test "fasta") generated 2 warnings [INFO] [stderr] Finished test [unoptimized + debuginfo] target(s) in 0.17s [INFO] [stdout] [INFO] [stderr] Running unittests (/opt/rustwide/target/debug/deps/seq_io-87dd89b780b7a529) [INFO] [stdout] running 9 tests [INFO] [stderr] Running tests/common.rs (/opt/rustwide/target/debug/deps/common-a389065d548b5fb8) [INFO] [stdout] test core::util::tests::test_simple_lines ... ok [INFO] [stderr] Running tests/fasta.rs (/opt/rustwide/target/debug/deps/fasta-802c06aad1612972) [INFO] [stdout] test fastx::recognition::tests::recognize_empty ... ok [INFO] [stdout] test fastx::recognition::tests::recognize_fasta1 ... ok [INFO] [stdout] test fastx::recognition::tests::recognize_fasta2 ... ok [INFO] [stdout] test core::util::tests::join_lines ... ok [INFO] [stdout] test fastx::recognition::tests::recognize_fasta3 ... ok [INFO] [stdout] test fastx::recognition::tests::recognize_fastq2 ... ok [INFO] [stdout] test fastx::recognition::tests::recognize_fastq1 ... ok [INFO] [stdout] test fastx::recognition::tests::recognize_invalid1 ... ok [INFO] [stdout] [INFO] [stdout] test result: ok. 9 passed; 0 failed; 0 ignored; 0 measured; 0 filtered out; finished in 0.01s [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] running 0 tests [INFO] [stdout] [INFO] [stdout] test result: ok. 0 passed; 0 failed; 0 ignored; 0 measured; 0 filtered out; finished in 0.00s [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] running 33 tests [INFO] [stdout] test single_line::invalid_start ... ok [INFO] [stdout] test single_line::none_after_err ... ok [INFO] [stdout] test single_line::empty ... ok [INFO] [stdout] test single_line::no_newline_end ... ok [INFO] [stdout] test standard::empty_lines_end ... ok [INFO] [stdout] test single_line::write_seq_iter ... ok [INFO] [stdout] test single_line::policy ... ok [INFO] [stdout] test standard::none_after_err ... ok [INFO] [stdout] test standard::policy ... ok [INFO] [stdout] test single_line::test_write_fasta ... ok [INFO] [stdout] test standard::invalid_start ... ok [INFO] [stdout] test single_line::write_seq_iter_wrap ... ok [INFO] [stdout] test standard::no_newline_end ... ok [INFO] [stdout] test standard::empty ... ok [INFO] [stdout] test single_line::write_seq_wrap ... ok [INFO] [stdout] test single_line::write_head ... ok [INFO] [stdout] test standard::no_seq ... ok [INFO] [stdout] test single_line::write_seq ... ok [INFO] [stdout] test standard::write_head ... ok [INFO] [stdout] test standard::test_write_fasta ... ok [INFO] [stdout] test standard::write_seq_iter ... ok [INFO] [stdout] test standard::write_seq ... ok [INFO] [stdout] test standard::write_seq_wrap ... ok [INFO] [stdout] test standard::write_seq_iter_wrap ... ok [INFO] [stdout] test single_line::empty_lines_end ... ok [INFO] [stdout] test standard::reader ... ok [INFO] [stdout] test single_line::record_set ... ok [INFO] [stdout] test standard::record_set ... ok [INFO] [stdout] test single_line::reader ... ok [INFO] [stdout] test standard::parallel ... FAILED [INFO] [stdout] test single_line::parallel ... FAILED [INFO] [stdout] test single_line::seek ... ok [INFO] [stderr] error: test failed, to rerun pass '--test fasta' [INFO] [stdout] test standard::seek ... ok [INFO] [stdout] [INFO] [stdout] failures: [INFO] [stdout] [INFO] [stdout] ---- standard::parallel stdout ---- [INFO] [stdout] thread 'standard::parallel' panicked at 'assertion failed: `(left == right)` [INFO] [stdout] left: `[[65, 84, 84, 71, 84, 84, 71, 84, 84, 84], [65, 84, 84, 71, 84, 84, 71, 84, 84, 84], [], [65, 84, 84, 71, 84, 84, 71, 84, 84, 84], [71, 71, 71, 71]]`, [INFO] [stdout] right: `[[65, 67, 67, 71, 84, 65, 71, 71, 67, 84], [], [67, 67, 71, 84, 65, 71, 71, 67, 84, 71], [67, 71, 84, 65, 71, 71, 67, 84, 71, 65], [], [71, 84, 65, 71, 71, 67, 84, 71, 65, 65], [67, 67, 67, 67], []]`: sequence line mismatch', tests/fasta.rs:16:5 [INFO] [stdout] stack backtrace: [INFO] [stdout] 0: 0x5622ea202d2c - std::backtrace_rs::backtrace::libunwind::trace::h7630ba4cba718aa0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/libunwind.rs:93:5 [INFO] [stdout] 1: 0x5622ea202d2c - std::backtrace_rs::backtrace::trace_unsynchronized::he7498e79c157f5ac [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/mod.rs:66:5 [INFO] [stdout] 2: 0x5622ea202d2c - std::sys_common::backtrace::_print_fmt::hdaebadaee17bca49 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:67:5 [INFO] [stdout] 3: 0x5622ea202d2c - ::fmt::h82b0e3aaf8a96140 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:46:22 [INFO] [stdout] 4: 0x5622ea2259bc - core::fmt::write::h72801a82c94e6ff1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/fmt/mod.rs:1149:17 [INFO] [stdout] 5: 0x5622ea1fea15 - std::io::Write::write_fmt::h21d7683cabdb4c35 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/io/mod.rs:1697:15 [INFO] [stdout] 6: 0x5622ea2047d0 - std::sys_common::backtrace::_print::h1c9a1d19c48821c1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:49:5 [INFO] [stdout] 7: 0x5622ea2047d0 - std::sys_common::backtrace::print::h7ce8802039fa9d0e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:36:9 [INFO] [stdout] 8: 0x5622ea2047d0 - std::panicking::default_hook::{{closure}}::hb2a74a8c1499c326 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:211:50 [INFO] [stdout] 9: 0x5622ea2043b6 - std::panicking::default_hook::hf4f180b00076f2b2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:225:9 [INFO] [stdout] 10: 0x5622ea204e84 - std::panicking::rust_panic_with_hook::he85ce8435493b711 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:606:17 [INFO] [stdout] 11: 0x5622ea204960 - std::panicking::begin_panic_handler::{{closure}}::h31e15f69e6235bd2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:502:13 [INFO] [stdout] 12: 0x5622ea2031e4 - std::sys_common::backtrace::__rust_end_short_backtrace::hfce2fadb61aaa3ae [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:139:18 [INFO] [stdout] 13: 0x5622ea2048c9 - rust_begin_unwind [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:498:5 [INFO] [stdout] 14: 0x5622ea0f9c81 - core::panicking::panic_fmt::h7b8580d81fcbbacd [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panicking.rs:107:14 [INFO] [stdout] 15: 0x5622ea22464e - core::panicking::assert_failed_inner::hc71171cfb6f4bc69 [INFO] [stdout] 16: 0x5622ea10875a - core::panicking::assert_failed::hd4b2b83b851b91c4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panicking.rs:145:5 [INFO] [stdout] 17: 0x5622ea116d43 - fasta::standard::parallel::{{closure}}::{{closure}}::h64a5a2a05b5cc514 [INFO] [stdout] at /opt/rustwide/workdir/tests/fasta.rs:16:5 [INFO] [stdout] 18: 0x5622ea15e0e2 - seq_io::parallel::read_process_fasta_records_init::{{closure}}::hc3824b3cb20282b3 [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:382:48 [INFO] [stdout] 19: 0x5622ea15b5c6 - seq_io::parallel::read_process_recordsets_init::{{closure}}::h8109f789900e1243 [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:229:19 [INFO] [stdout] 20: 0x5622ea0fd080 - crossbeam_utils::thread::scope::{{closure}}::h86cf60261c1b5147 [INFO] [stdout] at /opt/rustwide/cargo-home/registry/src/github.com-1ecc6299db9ec823/crossbeam-utils-0.8.5/src/thread.rs:160:65 [INFO] [stdout] 21: 0x5622ea15ed8f - as core::ops::function::FnOnce<()>>::call_once::ha2cb0f68a2d46e0a [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 22: 0x5622ea15784c - std::panicking::try::do_call::h78dc2c094289ec0a [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 23: 0x5622ea15e4ab - __rust_try [INFO] [stdout] 24: 0x5622ea15744e - std::panicking::try::ha8de9861275a917c [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 25: 0x5622ea0fd7ae - std::panic::catch_unwind::h4759a4cae5988ef4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 26: 0x5622ea0fc983 - crossbeam_utils::thread::scope::he83e28d1ca628695 [INFO] [stdout] at /opt/rustwide/cargo-home/registry/src/github.com-1ecc6299db9ec823/crossbeam-utils-0.8.5/src/thread.rs:160:18 [INFO] [stdout] 27: 0x5622ea15a73c - seq_io::parallel::read_process_recordsets_init::hf0b5cf24e78dc428 [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:169:5 [INFO] [stdout] 28: 0x5622ea15ced3 - seq_io::parallel::read_process_fasta_records_init::h7aace9e0818e2243 [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:364:13 [INFO] [stdout] 29: 0x5622ea15a021 - seq_io::parallel::read_process_fasta_records::h33e853a715a3335e [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:335:13 [INFO] [stdout] 30: 0x5622ea1176f5 - fasta::standard::parallel::{{closure}}::hd97ba58305201180 [INFO] [stdout] at /opt/rustwide/workdir/tests/fasta.rs:16:5 [INFO] [stdout] 31: 0x5622ea15790c - std::panicking::try::do_call::h7c2e765f5b0f03cc [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 32: 0x5622ea15e4ab - __rust_try [INFO] [stdout] 33: 0x5622ea1568e4 - std::panicking::try::h0925f03f5426e6db [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 34: 0x5622ea0fd9ae - std::panic::catch_unwind::hf3fed41821735c80 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 35: 0x5622ea1168c5 - fasta::standard::parallel::hc237fd1a70838195 [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:82:13 [INFO] [stdout] 36: 0x5622ea11680a - fasta::standard::parallel::{{closure}}::h2ec2f92d7bb1b2d4 [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:81:9 [INFO] [stdout] 37: 0x5622ea13f8fe - core::ops::function::FnOnce::call_once::h88e438e911ef6fa6 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 38: 0x5622ea1a1be3 - core::ops::function::FnOnce::call_once::h449577f1c5b077cb [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 39: 0x5622ea1a1be3 - test::__rust_begin_short_backtrace::h8c2a0a5090591869 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:585:5 [INFO] [stdout] 40: 0x5622ea1a0777 - as core::ops::function::FnOnce>::call_once::hea00a22128a38543 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 41: 0x5622ea1a0777 - as core::ops::function::FnOnce<()>>::call_once::he10b35c3c50d78a0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 42: 0x5622ea1a0777 - std::panicking::try::do_call::hc868e78bbc5af2ab [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 43: 0x5622ea1a0777 - std::panicking::try::he468aede74df1b04 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 44: 0x5622ea1a0777 - std::panic::catch_unwind::hce3c9152e1cf772d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 45: 0x5622ea1a0777 - test::run_test_in_process::h9c4ab8162080cf8c [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:608:18 [INFO] [stdout] 46: 0x5622ea1a0777 - test::run_test::run_test_inner::{{closure}}::he9483433cef16afe [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:500:39 [INFO] [stdout] 47: 0x5622ea16dabe - test::run_test::run_test_inner::{{closure}}::h479f1f872a5501ea [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:527:37 [INFO] [stdout] 48: 0x5622ea16dabe - std::sys_common::backtrace::__rust_begin_short_backtrace::h0f1e9b1f279687bc [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:123:18 [INFO] [stdout] 49: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::{{closure}}::he5560613c5f5cb83 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:484:17 [INFO] [stdout] 50: 0x5622ea1728e8 - as core::ops::function::FnOnce<()>>::call_once::h8190a68cb05ab92f [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 51: 0x5622ea1728e8 - std::panicking::try::do_call::h6ae22f5ac22596e4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 52: 0x5622ea1728e8 - std::panicking::try::h2381c25487d6a7c2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 53: 0x5622ea1728e8 - std::panic::catch_unwind::hfe902f4d5c9d7b6d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 54: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::h547fad40771a584e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:483:30 [INFO] [stdout] 55: 0x5622ea1728e8 - core::ops::function::FnOnce::call_once{{vtable.shim}}::he8602a9971738410 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 56: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::he162a5c338a10a39 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 57: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::hb27497b21740dd97 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 58: 0x5622ea209a13 - std::sys::unix::thread::Thread::new::thread_start::he467e990e49c5136 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys/unix/thread.rs:106:17 [INFO] [stdout] 59: 0x7efde6d5f609 - start_thread [INFO] [stdout] 60: 0x7efde6b31293 - clone [INFO] [stdout] 61: 0x0 - [INFO] [stdout] thread 'standard::parallel' panicked at 'Reader failed at capacity 3', tests/fasta.rs:16:5 [INFO] [stdout] stack backtrace: [INFO] [stdout] 0: 0x5622ea202d2c - std::backtrace_rs::backtrace::libunwind::trace::h7630ba4cba718aa0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/libunwind.rs:93:5 [INFO] [stdout] 1: 0x5622ea202d2c - std::backtrace_rs::backtrace::trace_unsynchronized::he7498e79c157f5ac [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/mod.rs:66:5 [INFO] [stdout] 2: 0x5622ea202d2c - std::sys_common::backtrace::_print_fmt::hdaebadaee17bca49 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:67:5 [INFO] [stdout] 3: 0x5622ea202d2c - ::fmt::h82b0e3aaf8a96140 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:46:22 [INFO] [stdout] 4: 0x5622ea2259bc - core::fmt::write::h72801a82c94e6ff1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/fmt/mod.rs:1149:17 [INFO] [stdout] 5: 0x5622ea1fea15 - std::io::Write::write_fmt::h21d7683cabdb4c35 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/io/mod.rs:1697:15 [INFO] [stdout] 6: 0x5622ea2047d0 - std::sys_common::backtrace::_print::h1c9a1d19c48821c1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:49:5 [INFO] [stdout] 7: 0x5622ea2047d0 - std::sys_common::backtrace::print::h7ce8802039fa9d0e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:36:9 [INFO] [stdout] 8: 0x5622ea2047d0 - std::panicking::default_hook::{{closure}}::hb2a74a8c1499c326 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:211:50 [INFO] [stdout] 9: 0x5622ea2043b6 - std::panicking::default_hook::hf4f180b00076f2b2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:225:9 [INFO] [stdout] 10: 0x5622ea204e84 - std::panicking::rust_panic_with_hook::he85ce8435493b711 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:606:17 [INFO] [stdout] 11: 0x5622ea204960 - std::panicking::begin_panic_handler::{{closure}}::h31e15f69e6235bd2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:502:13 [INFO] [stdout] 12: 0x5622ea2031e4 - std::sys_common::backtrace::__rust_end_short_backtrace::hfce2fadb61aaa3ae [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:139:18 [INFO] [stdout] 13: 0x5622ea2048c9 - rust_begin_unwind [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:498:5 [INFO] [stdout] 14: 0x5622ea0f9c81 - core::panicking::panic_fmt::h7b8580d81fcbbacd [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panicking.rs:107:14 [INFO] [stdout] 15: 0x5622ea1169a5 - fasta::standard::parallel::hc237fd1a70838195 [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:82:13 [INFO] [stdout] 16: 0x5622ea11680a - fasta::standard::parallel::{{closure}}::h2ec2f92d7bb1b2d4 [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:81:9 [INFO] [stdout] 17: 0x5622ea13f8fe - core::ops::function::FnOnce::call_once::h88e438e911ef6fa6 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 18: 0x5622ea1a1be3 - core::ops::function::FnOnce::call_once::h449577f1c5b077cb [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 19: 0x5622ea1a1be3 - test::__rust_begin_short_backtrace::h8c2a0a5090591869 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:585:5 [INFO] [stdout] 20: 0x5622ea1a0777 - as core::ops::function::FnOnce>::call_once::hea00a22128a38543 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 21: 0x5622ea1a0777 - as core::ops::function::FnOnce<()>>::call_once::he10b35c3c50d78a0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 22: 0x5622ea1a0777 - std::panicking::try::do_call::hc868e78bbc5af2ab [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 23: 0x5622ea1a0777 - std::panicking::try::he468aede74df1b04 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 24: 0x5622ea1a0777 - std::panic::catch_unwind::hce3c9152e1cf772d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 25: 0x5622ea1a0777 - test::run_test_in_process::h9c4ab8162080cf8c [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:608:18 [INFO] [stdout] 26: 0x5622ea1a0777 - test::run_test::run_test_inner::{{closure}}::he9483433cef16afe [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:500:39 [INFO] [stdout] 27: 0x5622ea16dabe - test::run_test::run_test_inner::{{closure}}::h479f1f872a5501ea [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:527:37 [INFO] [stdout] 28: 0x5622ea16dabe - std::sys_common::backtrace::__rust_begin_short_backtrace::h0f1e9b1f279687bc [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:123:18 [INFO] [stdout] 29: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::{{closure}}::he5560613c5f5cb83 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:484:17 [INFO] [stdout] 30: 0x5622ea1728e8 - as core::ops::function::FnOnce<()>>::call_once::h8190a68cb05ab92f [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 31: 0x5622ea1728e8 - std::panicking::try::do_call::h6ae22f5ac22596e4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 32: 0x5622ea1728e8 - std::panicking::try::h2381c25487d6a7c2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 33: 0x5622ea1728e8 - std::panic::catch_unwind::hfe902f4d5c9d7b6d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 34: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::h547fad40771a584e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:483:30 [INFO] [stdout] 35: 0x5622ea1728e8 - core::ops::function::FnOnce::call_once{{vtable.shim}}::he8602a9971738410 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 36: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::he162a5c338a10a39 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 37: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::hb27497b21740dd97 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 38: 0x5622ea209a13 - std::sys::unix::thread::Thread::new::thread_start::he467e990e49c5136 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys/unix/thread.rs:106:17 [INFO] [stdout] 39: 0x7efde6d5f609 - start_thread [INFO] [stdout] 40: 0x7efde6b31293 - clone [INFO] [stdout] 41: 0x0 - [INFO] [stdout] [INFO] [stdout] ---- single_line::parallel stdout ---- [INFO] [stdout] thread 'single_line::parallel' panicked at 'assertion failed: `(left == right)` [INFO] [stdout] left: `[[65, 84, 84, 71, 84, 84, 71, 84, 84, 84, 65, 84, 84, 71, 84, 84, 71, 84, 84, 84]]`, [INFO] [stdout] right: `[[65, 67, 67, 71, 84, 65, 71, 71, 67, 84, 67, 67, 71, 84, 65, 71, 71, 67, 84, 71]]`: sequence line mismatch', tests/fasta.rs:30:5 [INFO] [stdout] stack backtrace: [INFO] [stdout] 0: 0x5622ea202d2c - std::backtrace_rs::backtrace::libunwind::trace::h7630ba4cba718aa0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/libunwind.rs:93:5 [INFO] [stdout] 1: 0x5622ea202d2c - std::backtrace_rs::backtrace::trace_unsynchronized::he7498e79c157f5ac [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/mod.rs:66:5 [INFO] [stdout] 2: 0x5622ea202d2c - std::sys_common::backtrace::_print_fmt::hdaebadaee17bca49 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:67:5 [INFO] [stdout] 3: 0x5622ea202d2c - ::fmt::h82b0e3aaf8a96140 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:46:22 [INFO] [stdout] 4: 0x5622ea2259bc - core::fmt::write::h72801a82c94e6ff1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/fmt/mod.rs:1149:17 [INFO] [stdout] 5: 0x5622ea1fea15 - std::io::Write::write_fmt::h21d7683cabdb4c35 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/io/mod.rs:1697:15 [INFO] [stdout] 6: 0x5622ea2047d0 - std::sys_common::backtrace::_print::h1c9a1d19c48821c1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:49:5 [INFO] [stdout] 7: 0x5622ea2047d0 - std::sys_common::backtrace::print::h7ce8802039fa9d0e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:36:9 [INFO] [stdout] 8: 0x5622ea2047d0 - std::panicking::default_hook::{{closure}}::hb2a74a8c1499c326 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:211:50 [INFO] [stdout] 9: 0x5622ea2043b6 - std::panicking::default_hook::hf4f180b00076f2b2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:225:9 [INFO] [stdout] 10: 0x5622ea204e84 - std::panicking::rust_panic_with_hook::he85ce8435493b711 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:606:17 [INFO] [stdout] 11: 0x5622ea204960 - std::panicking::begin_panic_handler::{{closure}}::h31e15f69e6235bd2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:502:13 [INFO] [stdout] 12: 0x5622ea2031e4 - std::sys_common::backtrace::__rust_end_short_backtrace::hfce2fadb61aaa3ae [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:139:18 [INFO] [stdout] 13: 0x5622ea2048c9 - rust_begin_unwind [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:498:5 [INFO] [stdout] 14: 0x5622ea0f9c81 - core::panicking::panic_fmt::h7b8580d81fcbbacd [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panicking.rs:107:14 [INFO] [stdout] 15: 0x5622ea22464e - core::panicking::assert_failed_inner::hc71171cfb6f4bc69 [INFO] [stdout] 16: 0x5622ea10875a - core::panicking::assert_failed::hd4b2b83b851b91c4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panicking.rs:145:5 [INFO] [stdout] 17: 0x5622ea129a13 - fasta::single_line::parallel::{{closure}}::{{closure}}::h9647077e7947c605 [INFO] [stdout] at /opt/rustwide/workdir/tests/fasta.rs:30:5 [INFO] [stdout] 18: 0x5622ea15d7f2 - seq_io::parallel::read_process_fasta_records_init::{{closure}}::h68d0ea2657ab7db4 [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:382:48 [INFO] [stdout] 19: 0x5622ea15adf6 - seq_io::parallel::read_process_recordsets_init::{{closure}}::h31b8356f5be067e3 [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:229:19 [INFO] [stdout] 20: 0x5622ea0fd0e0 - crossbeam_utils::thread::scope::{{closure}}::h8972dcaa13f23893 [INFO] [stdout] at /opt/rustwide/cargo-home/registry/src/github.com-1ecc6299db9ec823/crossbeam-utils-0.8.5/src/thread.rs:160:65 [INFO] [stdout] 21: 0x5622ea15ed4f - as core::ops::function::FnOnce<()>>::call_once::h91d06b5e4feac885 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 22: 0x5622ea157a3c - std::panicking::try::do_call::had26198586cacac3 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 23: 0x5622ea15e4ab - __rust_try [INFO] [stdout] 24: 0x5622ea1569de - std::panicking::try::h151c5a54febf9a41 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 25: 0x5622ea0fd73e - std::panic::catch_unwind::h0edac229e6b2c2e7 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 26: 0x5622ea0fc2b3 - crossbeam_utils::thread::scope::hafc8e31523743150 [INFO] [stdout] at /opt/rustwide/cargo-home/registry/src/github.com-1ecc6299db9ec823/crossbeam-utils-0.8.5/src/thread.rs:160:18 [INFO] [stdout] 27: 0x5622ea15a3ec - seq_io::parallel::read_process_recordsets_init::h3b0fb3116d82713f [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:169:5 [INFO] [stdout] 28: 0x5622ea15cdc3 - seq_io::parallel::read_process_fasta_records_init::h0b2aec1c93b7962a [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:364:13 [INFO] [stdout] 29: 0x5622ea15a0c1 - seq_io::parallel::read_process_fasta_records::h4e75b3cb96d53fad [INFO] [stdout] at /opt/rustwide/workdir/src/parallel.rs:335:13 [INFO] [stdout] 30: 0x5622ea12a3c3 - fasta::single_line::parallel::{{closure}}::he9e0d264e95c6172 [INFO] [stdout] at /opt/rustwide/workdir/tests/fasta.rs:30:5 [INFO] [stdout] 31: 0x5622ea15794c - std::panicking::try::do_call::h88ba5cdf2e98e760 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 32: 0x5622ea15e4ab - __rust_try [INFO] [stdout] 33: 0x5622ea157594 - std::panicking::try::hb2713c1c2ea0c07c [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 34: 0x5622ea0fd88e - std::panic::catch_unwind::ha4a183a3d37c51c4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 35: 0x5622ea129595 - fasta::single_line::parallel::hda00e2e94c588c89 [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:82:13 [INFO] [stdout] 36: 0x5622ea1294da - fasta::single_line::parallel::{{closure}}::h65b3919bd1dfdfba [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:81:9 [INFO] [stdout] 37: 0x5622ea13e69e - core::ops::function::FnOnce::call_once::h1bf093308a3cba22 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 38: 0x5622ea1a1be3 - core::ops::function::FnOnce::call_once::h449577f1c5b077cb [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 39: 0x5622ea1a1be3 - test::__rust_begin_short_backtrace::h8c2a0a5090591869 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:585:5 [INFO] [stdout] 40: 0x5622ea1a0777 - as core::ops::function::FnOnce>::call_once::hea00a22128a38543 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 41: 0x5622ea1a0777 - as core::ops::function::FnOnce<()>>::call_once::he10b35c3c50d78a0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 42: 0x5622ea1a0777 - std::panicking::try::do_call::hc868e78bbc5af2ab [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 43: 0x5622ea1a0777 - std::panicking::try::he468aede74df1b04 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 44: 0x5622ea1a0777 - std::panic::catch_unwind::hce3c9152e1cf772d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 45: 0x5622ea1a0777 - test::run_test_in_process::h9c4ab8162080cf8c [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:608:18 [INFO] [stdout] 46: 0x5622ea1a0777 - test::run_test::run_test_inner::{{closure}}::he9483433cef16afe [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:500:39 [INFO] [stdout] 47: 0x5622ea16dabe - test::run_test::run_test_inner::{{closure}}::h479f1f872a5501ea [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:527:37 [INFO] [stdout] 48: 0x5622ea16dabe - std::sys_common::backtrace::__rust_begin_short_backtrace::h0f1e9b1f279687bc [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:123:18 [INFO] [stdout] 49: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::{{closure}}::he5560613c5f5cb83 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:484:17 [INFO] [stdout] 50: 0x5622ea1728e8 - as core::ops::function::FnOnce<()>>::call_once::h8190a68cb05ab92f [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 51: 0x5622ea1728e8 - std::panicking::try::do_call::h6ae22f5ac22596e4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 52: 0x5622ea1728e8 - std::panicking::try::h2381c25487d6a7c2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 53: 0x5622ea1728e8 - std::panic::catch_unwind::hfe902f4d5c9d7b6d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 54: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::h547fad40771a584e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:483:30 [INFO] [stdout] 55: 0x5622ea1728e8 - core::ops::function::FnOnce::call_once{{vtable.shim}}::he8602a9971738410 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 56: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::he162a5c338a10a39 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 57: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::hb27497b21740dd97 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 58: 0x5622ea209a13 - std::sys::unix::thread::Thread::new::thread_start::he467e990e49c5136 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys/unix/thread.rs:106:17 [INFO] [stdout] 59: 0x7efde6d5f609 - start_thread [INFO] [stdout] 60: 0x7efde6b31293 - clone [INFO] [stdout] 61: 0x0 - [INFO] [stdout] thread 'single_line::parallel' panicked at 'Reader failed at capacity 3', tests/fasta.rs:30:5 [INFO] [stdout] stack backtrace: [INFO] [stdout] 0: 0x5622ea202d2c - std::backtrace_rs::backtrace::libunwind::trace::h7630ba4cba718aa0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/libunwind.rs:93:5 [INFO] [stdout] 1: 0x5622ea202d2c - std::backtrace_rs::backtrace::trace_unsynchronized::he7498e79c157f5ac [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/../../backtrace/src/backtrace/mod.rs:66:5 [INFO] [stdout] 2: 0x5622ea202d2c - std::sys_common::backtrace::_print_fmt::hdaebadaee17bca49 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:67:5 [INFO] [stdout] 3: 0x5622ea202d2c - ::fmt::h82b0e3aaf8a96140 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:46:22 [INFO] [stdout] 4: 0x5622ea2259bc - core::fmt::write::h72801a82c94e6ff1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/fmt/mod.rs:1149:17 [INFO] [stdout] 5: 0x5622ea1fea15 - std::io::Write::write_fmt::h21d7683cabdb4c35 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/io/mod.rs:1697:15 [INFO] [stdout] 6: 0x5622ea2047d0 - std::sys_common::backtrace::_print::h1c9a1d19c48821c1 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:49:5 [INFO] [stdout] 7: 0x5622ea2047d0 - std::sys_common::backtrace::print::h7ce8802039fa9d0e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:36:9 [INFO] [stdout] 8: 0x5622ea2047d0 - std::panicking::default_hook::{{closure}}::hb2a74a8c1499c326 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:211:50 [INFO] [stdout] 9: 0x5622ea2043b6 - std::panicking::default_hook::hf4f180b00076f2b2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:225:9 [INFO] [stdout] 10: 0x5622ea204e84 - std::panicking::rust_panic_with_hook::he85ce8435493b711 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:606:17 [INFO] [stdout] 11: 0x5622ea204960 - std::panicking::begin_panic_handler::{{closure}}::h31e15f69e6235bd2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:502:13 [INFO] [stdout] 12: 0x5622ea2031e4 - std::sys_common::backtrace::__rust_end_short_backtrace::hfce2fadb61aaa3ae [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:139:18 [INFO] [stdout] 13: 0x5622ea2048c9 - rust_begin_unwind [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:498:5 [INFO] [stdout] 14: 0x5622ea0f9c81 - core::panicking::panic_fmt::h7b8580d81fcbbacd [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panicking.rs:107:14 [INFO] [stdout] 15: 0x5622ea129675 - fasta::single_line::parallel::hda00e2e94c588c89 [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:82:13 [INFO] [stdout] 16: 0x5622ea1294da - fasta::single_line::parallel::{{closure}}::h65b3919bd1dfdfba [INFO] [stdout] at /opt/rustwide/workdir/tests/common.rs:81:9 [INFO] [stdout] 17: 0x5622ea13e69e - core::ops::function::FnOnce::call_once::h1bf093308a3cba22 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 18: 0x5622ea1a1be3 - core::ops::function::FnOnce::call_once::h449577f1c5b077cb [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 19: 0x5622ea1a1be3 - test::__rust_begin_short_backtrace::h8c2a0a5090591869 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:585:5 [INFO] [stdout] 20: 0x5622ea1a0777 - as core::ops::function::FnOnce>::call_once::hea00a22128a38543 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 21: 0x5622ea1a0777 - as core::ops::function::FnOnce<()>>::call_once::he10b35c3c50d78a0 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 22: 0x5622ea1a0777 - std::panicking::try::do_call::hc868e78bbc5af2ab [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 23: 0x5622ea1a0777 - std::panicking::try::he468aede74df1b04 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 24: 0x5622ea1a0777 - std::panic::catch_unwind::hce3c9152e1cf772d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 25: 0x5622ea1a0777 - test::run_test_in_process::h9c4ab8162080cf8c [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:608:18 [INFO] [stdout] 26: 0x5622ea1a0777 - test::run_test::run_test_inner::{{closure}}::he9483433cef16afe [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:500:39 [INFO] [stdout] 27: 0x5622ea16dabe - test::run_test::run_test_inner::{{closure}}::h479f1f872a5501ea [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/test/src/lib.rs:527:37 [INFO] [stdout] 28: 0x5622ea16dabe - std::sys_common::backtrace::__rust_begin_short_backtrace::h0f1e9b1f279687bc [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys_common/backtrace.rs:123:18 [INFO] [stdout] 29: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::{{closure}}::he5560613c5f5cb83 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:484:17 [INFO] [stdout] 30: 0x5622ea1728e8 - as core::ops::function::FnOnce<()>>::call_once::h8190a68cb05ab92f [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/panic/unwind_safe.rs:271:9 [INFO] [stdout] 31: 0x5622ea1728e8 - std::panicking::try::do_call::h6ae22f5ac22596e4 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:406:40 [INFO] [stdout] 32: 0x5622ea1728e8 - std::panicking::try::h2381c25487d6a7c2 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panicking.rs:370:19 [INFO] [stdout] 33: 0x5622ea1728e8 - std::panic::catch_unwind::hfe902f4d5c9d7b6d [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/panic.rs:133:14 [INFO] [stdout] 34: 0x5622ea1728e8 - std::thread::Builder::spawn_unchecked::{{closure}}::h547fad40771a584e [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/thread/mod.rs:483:30 [INFO] [stdout] 35: 0x5622ea1728e8 - core::ops::function::FnOnce::call_once{{vtable.shim}}::he8602a9971738410 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/core/src/ops/function.rs:227:5 [INFO] [stdout] 36: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::he162a5c338a10a39 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 37: 0x5622ea209a13 - as core::ops::function::FnOnce>::call_once::hb27497b21740dd97 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/alloc/src/boxed.rs:1694:9 [INFO] [stdout] 38: 0x5622ea209a13 - std::sys::unix::thread::Thread::new::thread_start::he467e990e49c5136 [INFO] [stdout] at /rustc/722e1797249a965b6335aebd65d777f917e498f1/library/std/src/sys/unix/thread.rs:106:17 [INFO] [stdout] 39: 0x7efde6d5f609 - start_thread [INFO] [stdout] 40: 0x7efde6b31293 - clone [INFO] [stdout] 41: 0x0 - [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] failures: [INFO] [stdout] single_line::parallel [INFO] [stdout] standard::parallel [INFO] [stdout] [INFO] [stdout] test result: FAILED. 31 passed; 2 failed; 0 ignored; 0 measured; 0 filtered out; finished in 0.18s [INFO] [stdout] [INFO] running `Command { std: "docker" "inspect" "445cd766919bb5c23d395d4a51d8e27ef5304e3df212370ac40fef93bbcabded", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "445cd766919bb5c23d395d4a51d8e27ef5304e3df212370ac40fef93bbcabded", kill_on_drop: false }` [INFO] [stdout] 445cd766919bb5c23d395d4a51d8e27ef5304e3df212370ac40fef93bbcabded