[INFO] fetching crate rna-algos 0.1.18...
[INFO] checking rna-algos-0.1.18 against master#6526e5c772f2da07db745c94ca6bb0a591a39ba4 for pr-80920
[INFO] extracting crate rna-algos 0.1.18 into /workspace/builds/worker-10/source
[INFO] validating manifest of crates.io crate rna-algos 0.1.18 on toolchain 6526e5c772f2da07db745c94ca6bb0a591a39ba4
[INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+6526e5c772f2da07db745c94ca6bb0a591a39ba4" "read-manifest" "--manifest-path" "Cargo.toml", kill_on_drop: false }`
[INFO] started tweaking crates.io crate rna-algos 0.1.18
[INFO] finished tweaking crates.io crate rna-algos 0.1.18
[INFO] tweaked toml for crates.io crate rna-algos 0.1.18 written to /workspace/builds/worker-10/source/Cargo.toml
[INFO] crate crates.io crate rna-algos 0.1.18 already has a lockfile, it will not be regenerated
[INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+6526e5c772f2da07db745c94ca6bb0a591a39ba4" "fetch" "--locked" "--manifest-path" "Cargo.toml", kill_on_drop: false }`
[INFO] [stderr]     Blocking waiting for file lock on package cache
[INFO] [stderr]     Blocking waiting for file lock on package cache
[INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-10/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-10/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:21f1ed92105a0ef9b0d27ad8bdeb7f36f9f01ac17fffe3a3f3dc5241fc25d8f4" "/opt/rustwide/cargo-home/bin/cargo" "+6526e5c772f2da07db745c94ca6bb0a591a39ba4" "metadata" "--no-deps" "--format-version=1", kill_on_drop: false }`
[INFO] [stdout] 65e47468e98aa5f83e0b313051b808428783e5f2845671183bd35f90dddf6ecc
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] running `Command { std: "docker" "start" "-a" "65e47468e98aa5f83e0b313051b808428783e5f2845671183bd35f90dddf6ecc", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "inspect" "65e47468e98aa5f83e0b313051b808428783e5f2845671183bd35f90dddf6ecc", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "rm" "-f" "65e47468e98aa5f83e0b313051b808428783e5f2845671183bd35f90dddf6ecc", kill_on_drop: false }`
[INFO] [stdout] 65e47468e98aa5f83e0b313051b808428783e5f2845671183bd35f90dddf6ecc
[INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-10/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-10/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:21f1ed92105a0ef9b0d27ad8bdeb7f36f9f01ac17fffe3a3f3dc5241fc25d8f4" "/opt/rustwide/cargo-home/bin/cargo" "+6526e5c772f2da07db745c94ca6bb0a591a39ba4" "check" "--frozen" "--all" "--all-targets" "--message-format=json", kill_on_drop: false }`
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] [stdout] 02aeab3c934402716c43b6102aa5a417a3061a8e07d7fc882a9ead42fc26a5c5
[INFO] running `Command { std: "docker" "start" "-a" "02aeab3c934402716c43b6102aa5a417a3061a8e07d7fc882a9ead42fc26a5c5", kill_on_drop: false }`
[INFO] [stderr]    Compiling syn v1.0.58
[INFO] [stderr]    Compiling serde_derive v1.0.118
[INFO] [stderr]    Compiling memchr v2.3.4
[INFO] [stderr]    Compiling serde v1.0.118
[INFO] [stderr]    Compiling libc v0.2.81
[INFO] [stderr]    Compiling matrixmultiply v0.1.15
[INFO] [stderr]     Checking either v1.6.1
[INFO] [stderr]     Checking ucd-util v0.1.8
[INFO] [stderr]    Compiling regex v0.2.11
[INFO] [stderr]     Checking rawpointer v0.1.0
[INFO] [stderr]     Checking utf8-ranges v1.0.4
[INFO] [stderr]     Checking bit-vec v0.4.4
[INFO] [stderr]     Checking lazy_static v0.1.16
[INFO] [stderr]     Checking lazy_static v0.2.11
[INFO] [stderr]     Checking approx v0.1.1
[INFO] [stderr]     Checking unicode-width v0.1.8
[INFO] [stderr]    Compiling num-traits v0.2.14
[INFO] [stderr]    Compiling num-integer v0.1.44
[INFO] [stderr]    Compiling num-bigint v0.3.1
[INFO] [stderr]    Compiling num-iter v0.1.42
[INFO] [stderr]    Compiling num-rational v0.3.2
[INFO] [stderr]     Checking thread_local v0.3.6
[INFO] [stderr]     Checking unreachable v1.0.0
[INFO] [stderr]     Checking getopts v0.2.21
[INFO] [stderr]     Checking itertools v0.6.5
[INFO] [stderr]     Checking itertools v0.8.2
[INFO] [stderr]    Compiling newtype_derive v0.1.6
[INFO] [stderr]     Checking regex-syntax v0.5.6
[INFO] [stderr]     Checking bit-set v0.4.0
[INFO] [stderr]     Checking regex-automata v0.1.9
[INFO] [stderr]     Checking aho-corasick v0.6.10
[INFO] [stderr]     Checking csv-core v0.1.10
[INFO] [stderr]     Checking num-traits v0.1.43
[INFO] [stderr]     Checking num-complex v0.1.43
[INFO] [stderr]     Checking num-complex v0.3.1
[INFO] [stderr]     Checking itertools-num v0.1.3
[INFO] [stderr]     Checking ordered-float v0.5.2
[INFO] [stderr]     Checking time v0.1.44
[INFO] [stderr]     Checking num_cpus v1.13.0
[INFO] [stderr]     Checking bio-seq-algos v0.1.17
[INFO] [stderr]     Checking ndarray v0.9.1
[INFO] [stderr]     Checking rna-ss-params v0.1.19
[INFO] [stderr]     Checking num v0.3.1
[INFO] [stderr]     Checking bstr v0.2.14
[INFO] [stderr]     Checking bv v0.7.4
[INFO] [stderr]     Checking vec_map v0.8.2
[INFO] [stderr]     Checking multimap v0.4.0
[INFO] [stderr]     Checking csv v1.1.5
[INFO] [stderr]     Checking bio v0.20.3
[INFO] [stderr]     Checking rna-algos v0.1.18 (/opt/rustwide/workdir)
[INFO] [stdout] error[E0425]: cannot find function `get_bpp_and_unpair_prob_mats` in this scope
[INFO] [stdout]   --> tests/tests.rs:20:11
[INFO] [stdout]    |
[INFO] [stdout] 20 |   let _ = get_bpp_and_unpair_prob_mats(&TEST_SEQ[..]);
[INFO] [stdout]    |           ^^^^^^^^^^^^^^^^^^^^^^^^^^^^ not found in this scope
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: unused import: `rna_algos::mccaskill_algo::*`
[INFO] [stdout]  --> tests/tests.rs:7:5
[INFO] [stdout]   |
[INFO] [stdout] 7 | use rna_algos::mccaskill_algo::*;
[INFO] [stdout]   |     ^^^^^^^^^^^^^^^^^^^^^^^^^^^^
[INFO] [stdout]   |
[INFO] [stdout]   = note: `#[warn(unused_imports)]` on by default
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: unnecessary braces around block return value
[INFO] [stdout]   --> tests/tests.rs:14:36
[INFO] [stdout]    |
[INFO] [stdout] 14 |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout]    |                                    ^^^^^^^^^^^^^^^^ help: remove these braces
[INFO] [stdout]    |
[INFO] [stdout]    = note: `#[warn(unused_braces)]` on by default
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: `#[warn(deprecated)]` on by default
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] error: aborting due to previous error; 6 warnings emitted
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] For more information about this error, try `rustc --explain E0425`.
[INFO] [stdout] 
[INFO] [stderr] error: could not compile `rna-algos`
[INFO] [stderr] 
[INFO] [stderr] To learn more, run the command again with --verbose.
[INFO] [stderr] warning: build failed, waiting for other jobs to finish...
[INFO] [stderr] error: build failed
[INFO] running `Command { std: "docker" "inspect" "02aeab3c934402716c43b6102aa5a417a3061a8e07d7fc882a9ead42fc26a5c5", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "rm" "-f" "02aeab3c934402716c43b6102aa5a417a3061a8e07d7fc882a9ead42fc26a5c5", kill_on_drop: false }`
[INFO] [stdout] 02aeab3c934402716c43b6102aa5a417a3061a8e07d7fc882a9ead42fc26a5c5