[INFO] fetching crate rna-algos 0.1.16...
[INFO] testing rna-algos-0.1.16 against try#eafdee2dfae8c2233b74f98b123308be7ccefcc6 for pr-79296
[INFO] extracting crate rna-algos 0.1.16 into /workspace/builds/worker-4/source
[INFO] validating manifest of crates.io crate rna-algos 0.1.16 on toolchain eafdee2dfae8c2233b74f98b123308be7ccefcc6
[INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+eafdee2dfae8c2233b74f98b123308be7ccefcc6" "read-manifest" "--manifest-path" "Cargo.toml", kill_on_drop: false }`
[INFO] started tweaking crates.io crate rna-algos 0.1.16
[INFO] finished tweaking crates.io crate rna-algos 0.1.16
[INFO] tweaked toml for crates.io crate rna-algos 0.1.16 written to /workspace/builds/worker-4/source/Cargo.toml
[INFO] crate crates.io crate rna-algos 0.1.16 already has a lockfile, it will not be regenerated
[INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+eafdee2dfae8c2233b74f98b123308be7ccefcc6" "fetch" "--locked" "--manifest-path" "Cargo.toml", kill_on_drop: false }`
[INFO] [stderr]  Downloading crates ...
[INFO] [stderr]   Downloaded num-rational v0.3.1
[INFO] [stderr]   Downloaded rna-ss-params v0.1.17
[INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-4/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-4/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:6eabd152ff4036248d66efda456a36cb33d24b7291b33f25f75140726c88da35" "/opt/rustwide/cargo-home/bin/cargo" "+eafdee2dfae8c2233b74f98b123308be7ccefcc6" "metadata" "--no-deps" "--format-version=1", kill_on_drop: false }`
[INFO] [stdout] a3dbbc9ca62cb7843caf2ba811a16d2c1a0fe09b07f452106b05689265b5012c
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] running `Command { std: "docker" "start" "-a" "a3dbbc9ca62cb7843caf2ba811a16d2c1a0fe09b07f452106b05689265b5012c", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "inspect" "a3dbbc9ca62cb7843caf2ba811a16d2c1a0fe09b07f452106b05689265b5012c", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "rm" "-f" "a3dbbc9ca62cb7843caf2ba811a16d2c1a0fe09b07f452106b05689265b5012c", kill_on_drop: false }`
[INFO] [stdout] a3dbbc9ca62cb7843caf2ba811a16d2c1a0fe09b07f452106b05689265b5012c
[INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-4/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-4/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:6eabd152ff4036248d66efda456a36cb33d24b7291b33f25f75140726c88da35" "/opt/rustwide/cargo-home/bin/cargo" "+eafdee2dfae8c2233b74f98b123308be7ccefcc6" "build" "--frozen" "--message-format=json", kill_on_drop: false }`
[INFO] [stdout] fbb47e4aff323439d3df7435f79b06d2ce2db73975591d79536b384af0df4b1e
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] running `Command { std: "docker" "start" "-a" "fbb47e4aff323439d3df7435f79b06d2ce2db73975591d79536b384af0df4b1e", kill_on_drop: false }`
[INFO] [stderr]     Blocking waiting for file lock on package cache
[INFO] [stderr]    Compiling autocfg v1.0.1
[INFO] [stderr]    Compiling proc-macro2 v1.0.24
[INFO] [stderr]    Compiling unicode-xid v0.2.1
[INFO] [stderr]    Compiling syn v1.0.48
[INFO] [stderr]    Compiling serde_derive v1.0.117
[INFO] [stderr]    Compiling memchr v2.3.4
[INFO] [stderr]    Compiling byteorder v1.3.4
[INFO] [stderr]    Compiling libc v0.2.80
[INFO] [stderr]    Compiling semver v0.1.20
[INFO] [stderr]    Compiling lazy_static v1.4.0
[INFO] [stderr]    Compiling matrixmultiply v0.1.15
[INFO] [stderr]    Compiling ryu v1.0.5
[INFO] [stderr]    Compiling either v1.6.1
[INFO] [stderr]    Compiling ndarray v0.9.1
[INFO] [stderr]    Compiling bv v0.7.4
[INFO] [stderr]    Compiling rawpointer v0.1.0
[INFO] [stderr]    Compiling bit-vec v0.4.4
[INFO] [stderr]    Compiling itoa v0.4.6
[INFO] [stderr]    Compiling lazy_static v0.1.16
[INFO] [stderr]    Compiling hashbrown v0.3.1
[INFO] [stderr]    Compiling approx v0.1.1
[INFO] [stderr]    Compiling custom_derive v0.1.7
[INFO] [stderr]    Compiling unicode-width v0.1.8
[INFO] [stderr]    Compiling lazy_static v0.2.11
[INFO] [stderr]    Compiling bytecount v0.3.2
[INFO] [stderr]    Compiling quick-error v1.2.3
[INFO] [stderr]    Compiling scoped_threadpool v0.1.9
[INFO] [stderr]    Compiling thread_local v0.3.6
[INFO] [stderr]    Compiling bit-set v0.4.0
[INFO] [stderr]    Compiling itertools v0.6.5
[INFO] [stderr]    Compiling itertools v0.8.2
[INFO] [stderr]    Compiling getopts v0.2.21
[INFO] [stderr]    Compiling rustc_version v0.1.7
[INFO] [stderr]    Compiling regex-automata v0.1.9
[INFO] [stderr]    Compiling fxhash v0.2.1
[INFO] [stderr]    Compiling aho-corasick v0.6.10
[INFO] [stderr]    Compiling csv-core v0.1.10
[INFO] [stderr]    Compiling newtype_derive v0.1.6
[INFO] [stderr]    Compiling num-traits v0.2.14
[INFO] [stderr]    Compiling num-integer v0.1.44
[INFO] [stderr]    Compiling num-bigint v0.3.1
[INFO] [stderr]    Compiling num-rational v0.3.1
[INFO] [stderr]    Compiling num-iter v0.1.42
[INFO] [stderr]    Compiling time v0.1.44
[INFO] [stderr]    Compiling num_cpus v1.13.0
[INFO] [stderr]    Compiling quote v1.0.7
[INFO] [stderr]    Compiling regex v0.2.11
[INFO] [stderr]    Compiling bio-seq-algos v0.1.17
[INFO] [stderr]    Compiling rna-ss-params v0.1.17
[INFO] [stderr]    Compiling num-traits v0.1.43
[INFO] [stderr]    Compiling num-complex v0.1.43
[INFO] [stderr]    Compiling itertools-num v0.1.3
[INFO] [stderr]    Compiling num-complex v0.3.1
[INFO] [stderr]    Compiling ordered-float v0.5.2
[INFO] [stderr]    Compiling num v0.3.1
[INFO] [stderr]    Compiling serde v1.0.117
[INFO] [stderr]    Compiling bstr v0.2.14
[INFO] [stderr]    Compiling multimap v0.4.0
[INFO] [stderr]    Compiling vec_map v0.8.2
[INFO] [stderr]    Compiling csv v1.1.4
[INFO] [stderr]    Compiling bio v0.20.3
[INFO] [stderr]    Compiling rna-algos v0.1.16 (/opt/rustwide/workdir)
[INFO] [stderr]     Finished dev [unoptimized + debuginfo] target(s) in 1m 03s
[INFO] running `Command { std: "docker" "inspect" "fbb47e4aff323439d3df7435f79b06d2ce2db73975591d79536b384af0df4b1e", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "rm" "-f" "fbb47e4aff323439d3df7435f79b06d2ce2db73975591d79536b384af0df4b1e", kill_on_drop: false }`
[INFO] [stdout] fbb47e4aff323439d3df7435f79b06d2ce2db73975591d79536b384af0df4b1e
[INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-4/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-4/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:6eabd152ff4036248d66efda456a36cb33d24b7291b33f25f75140726c88da35" "/opt/rustwide/cargo-home/bin/cargo" "+eafdee2dfae8c2233b74f98b123308be7ccefcc6" "test" "--frozen" "--no-run" "--message-format=json", kill_on_drop: false }`
[INFO] [stdout] 7488699a41ec325bac8f70c1c3c462faa49faa4731c959565c1120c442aa3a2d
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] running `Command { std: "docker" "start" "-a" "7488699a41ec325bac8f70c1c3c462faa49faa4731c959565c1120c442aa3a2d", kill_on_drop: false }`
[INFO] [stderr]    Compiling rna-algos v0.1.16 (/opt/rustwide/workdir)
[INFO] [stdout] warning: unnecessary braces around block return value
[INFO] [stdout]   --> tests/tests.rs:14:36
[INFO] [stdout]    |
[INFO] [stdout] 14 |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout]    |                                    ^^^^^^^^^^^^^^^^ help: remove these braces
[INFO] [stdout]    |
[INFO] [stdout]    = note: `#[warn(unused_braces)]` on by default
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: `#[warn(deprecated)]` on by default
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred
[INFO] [stdout]   --> tests/tests.rs:10:1
[INFO] [stdout]    |
[INFO] [stdout] 10 | / lazy_static! {
[INFO] [stdout] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stdout] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stdout] 13 | |   };
[INFO] [stdout] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stdout] 15 | | }
[INFO] [stdout]    | |_^
[INFO] [stdout]    |
[INFO] [stdout]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] error[E0283]: type annotations needed for `(SsProbMats<T>, Vec<f32>, SsFreeEnergyMats<T>)`
[INFO] [stdout]   --> tests/tests.rs:20:11
[INFO] [stdout]    |
[INFO] [stdout] 20 |   let _ = get_bpp_and_unpair_prob_mats(&TEST_SEQ[..]);
[INFO] [stdout]    |       -   ^^^^^^^^^^^^^^^^^^^^^^^^^^^^ cannot infer type for type parameter `T` declared on the function `get_bpp_and_unpair_prob_mats`
[INFO] [stdout]    |       |
[INFO] [stdout]    |       consider giving this pattern the explicit type `(SsProbMats<T>, Vec<f32>, SsFreeEnergyMats<T>)`, where the type parameter `T` is specified
[INFO] [stdout]    | 
[INFO] [stdout]   ::: /opt/rustwide/workdir/src/mccaskill_algo.rs:80:6
[INFO] [stdout]    |
[INFO] [stdout] 80 |   T: Unsigned + PrimInt + Hash + FromPrimitive + Integer,
[INFO] [stdout]    |      -------- required by this bound in `rna_algos::mccaskill_algo::get_bpp_and_unpair_prob_mats`
[INFO] [stdout]    |
[INFO] [stdout]    = note: cannot satisfy `_: Unsigned`
[INFO] [stdout] help: consider specifying the type argument in the function call
[INFO] [stdout]    |
[INFO] [stdout] 20 |   let _ = get_bpp_and_unpair_prob_mats::<T>(&TEST_SEQ[..]);
[INFO] [stdout]    |                                       ^^^^^
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] error: aborting due to previous error; 5 warnings emitted
[INFO] [stdout] 
[INFO] [stdout] 
[INFO] [stdout] For more information about this error, try `rustc --explain E0283`.
[INFO] [stdout] 
[INFO] [stderr] error: could not compile `rna-algos`
[INFO] [stderr] 
[INFO] [stderr] To learn more, run the command again with --verbose.
[INFO] [stderr] warning: build failed, waiting for other jobs to finish...
[INFO] [stderr] error: build failed
[INFO] running `Command { std: "docker" "inspect" "7488699a41ec325bac8f70c1c3c462faa49faa4731c959565c1120c442aa3a2d", kill_on_drop: false }`
[INFO] running `Command { std: "docker" "rm" "-f" "7488699a41ec325bac8f70c1c3c462faa49faa4731c959565c1120c442aa3a2d", kill_on_drop: false }`
[INFO] [stdout] 7488699a41ec325bac8f70c1c3c462faa49faa4731c959565c1120c442aa3a2d