[INFO] fetching crate rna-algos 0.1.16... [INFO] testing rna-algos-0.1.16 against master#5d5ff84130da0d74c6ece368dbe821d8f83fa526 for pr-79296 [INFO] extracting crate rna-algos 0.1.16 into /workspace/builds/worker-2/source [INFO] validating manifest of crates.io crate rna-algos 0.1.16 on toolchain 5d5ff84130da0d74c6ece368dbe821d8f83fa526 [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+5d5ff84130da0d74c6ece368dbe821d8f83fa526" "read-manifest" "--manifest-path" "Cargo.toml", kill_on_drop: false }` [INFO] started tweaking crates.io crate rna-algos 0.1.16 [INFO] finished tweaking crates.io crate rna-algos 0.1.16 [INFO] tweaked toml for crates.io crate rna-algos 0.1.16 written to /workspace/builds/worker-2/source/Cargo.toml [INFO] crate crates.io crate rna-algos 0.1.16 already has a lockfile, it will not be regenerated [INFO] running `Command { std: "/workspace/cargo-home/bin/cargo" "+5d5ff84130da0d74c6ece368dbe821d8f83fa526" "fetch" "--locked" "--manifest-path" "Cargo.toml", kill_on_drop: false }` [INFO] [stderr] Blocking waiting for file lock on package cache [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-2/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-2/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:6eabd152ff4036248d66efda456a36cb33d24b7291b33f25f75140726c88da35" "/opt/rustwide/cargo-home/bin/cargo" "+5d5ff84130da0d74c6ece368dbe821d8f83fa526" "metadata" "--no-deps" "--format-version=1", kill_on_drop: false }` [INFO] [stdout] cbcdb7c4bfd3b9792b727c693516e4c12f680e0af588a07d20c4473fe35122d6 [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] running `Command { std: "docker" "start" "-a" "cbcdb7c4bfd3b9792b727c693516e4c12f680e0af588a07d20c4473fe35122d6", kill_on_drop: false }` [INFO] running `Command { std: "docker" "inspect" "cbcdb7c4bfd3b9792b727c693516e4c12f680e0af588a07d20c4473fe35122d6", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "cbcdb7c4bfd3b9792b727c693516e4c12f680e0af588a07d20c4473fe35122d6", kill_on_drop: false }` [INFO] [stdout] cbcdb7c4bfd3b9792b727c693516e4c12f680e0af588a07d20c4473fe35122d6 [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-2/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-2/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:6eabd152ff4036248d66efda456a36cb33d24b7291b33f25f75140726c88da35" "/opt/rustwide/cargo-home/bin/cargo" "+5d5ff84130da0d74c6ece368dbe821d8f83fa526" "build" "--frozen" "--message-format=json", kill_on_drop: false }` [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] [stdout] 16cdfdfe9fc92503d07e63a8b955e99a9f1eb596cb014422a63b3357cfc28f57 [INFO] running `Command { std: "docker" "start" "-a" "16cdfdfe9fc92503d07e63a8b955e99a9f1eb596cb014422a63b3357cfc28f57", kill_on_drop: false }` [INFO] [stderr] Compiling syn v1.0.48 [INFO] [stderr] Compiling libc v0.2.80 [INFO] [stderr] Compiling semver v0.1.20 [INFO] [stderr] Compiling either v1.6.1 [INFO] [stderr] Compiling matrixmultiply v0.1.15 [INFO] [stderr] Compiling rawpointer v0.1.0 [INFO] [stderr] Compiling void v1.0.2 [INFO] [stderr] Compiling bv v0.7.4 [INFO] [stderr] Compiling ndarray v0.9.1 [INFO] [stderr] Compiling bit-vec v0.4.4 [INFO] [stderr] Compiling hashbrown v0.3.1 [INFO] [stderr] Compiling lazy_static v0.1.16 [INFO] [stderr] Compiling bytecount v0.3.2 [INFO] [stderr] Compiling approx v0.1.1 [INFO] [stderr] Compiling custom_derive v0.1.7 [INFO] [stderr] Compiling unicode-width v0.1.8 [INFO] [stderr] Compiling lazy_static v0.2.11 [INFO] [stderr] Compiling scoped_threadpool v0.1.9 [INFO] [stderr] Compiling num-traits v0.2.14 [INFO] [stderr] Compiling num-integer v0.1.44 [INFO] [stderr] Compiling num-bigint v0.3.1 [INFO] [stderr] Compiling num-rational v0.3.1 [INFO] [stderr] Compiling num-iter v0.1.42 [INFO] [stderr] Compiling thread_local v0.3.6 [INFO] [stderr] Compiling getopts v0.2.21 [INFO] [stderr] Compiling unreachable v1.0.0 [INFO] [stderr] Compiling itertools v0.6.5 [INFO] [stderr] Compiling itertools v0.8.2 [INFO] [stderr] Compiling bit-set v0.4.0 [INFO] [stderr] Compiling csv-core v0.1.10 [INFO] [stderr] Compiling aho-corasick v0.6.10 [INFO] [stderr] Compiling regex-automata v0.1.9 [INFO] [stderr] Compiling rustc_version v0.1.7 [INFO] [stderr] Compiling regex v0.2.11 [INFO] [stderr] Compiling newtype_derive v0.1.6 [INFO] [stderr] Compiling time v0.1.44 [INFO] [stderr] Compiling num_cpus v1.13.0 [INFO] [stderr] Compiling num-traits v0.1.43 [INFO] [stderr] Compiling num-complex v0.1.43 [INFO] [stderr] Compiling itertools-num v0.1.3 [INFO] [stderr] Compiling num-complex v0.3.1 [INFO] [stderr] Compiling bio-seq-algos v0.1.17 [INFO] [stderr] Compiling ordered-float v0.5.2 [INFO] [stderr] Compiling rna-ss-params v0.1.17 [INFO] [stderr] Compiling serde_derive v1.0.117 [INFO] [stderr] Compiling num v0.3.1 [INFO] [stderr] Compiling serde v1.0.117 [INFO] [stderr] Compiling bstr v0.2.14 [INFO] [stderr] Compiling multimap v0.4.0 [INFO] [stderr] Compiling vec_map v0.8.2 [INFO] [stderr] Compiling csv v1.1.4 [INFO] [stderr] Compiling bio v0.20.3 [INFO] [stderr] Compiling rna-algos v0.1.16 (/opt/rustwide/workdir) [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 59.12s [INFO] running `Command { std: "docker" "inspect" "16cdfdfe9fc92503d07e63a8b955e99a9f1eb596cb014422a63b3357cfc28f57", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "16cdfdfe9fc92503d07e63a8b955e99a9f1eb596cb014422a63b3357cfc28f57", kill_on_drop: false }` [INFO] [stdout] 16cdfdfe9fc92503d07e63a8b955e99a9f1eb596cb014422a63b3357cfc28f57 [INFO] running `Command { std: "docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-2/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-2/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--user" "0:0" "--network" "none" "rustops/crates-build-env@sha256:6eabd152ff4036248d66efda456a36cb33d24b7291b33f25f75140726c88da35" "/opt/rustwide/cargo-home/bin/cargo" "+5d5ff84130da0d74c6ece368dbe821d8f83fa526" "test" "--frozen" "--no-run" "--message-format=json", kill_on_drop: false }` [INFO] [stdout] ce84c04a20931a78619911e812b3b38bda94942b464bfb987876653450ba04c0 [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] running `Command { std: "docker" "start" "-a" "ce84c04a20931a78619911e812b3b38bda94942b464bfb987876653450ba04c0", kill_on_drop: false }` [INFO] [stderr] Compiling rna-algos v0.1.16 (/opt/rustwide/workdir) [INFO] [stdout] warning: unnecessary braces around block return value [INFO] [stdout] --> tests/tests.rs:14:36 [INFO] [stdout] | [INFO] [stdout] 14 | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stdout] | ^^^^^^^^^^^^^^^^ help: remove these braces [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(unused_braces)]` on by default [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred [INFO] [stdout] --> tests/tests.rs:10:1 [INFO] [stdout] | [INFO] [stdout] 10 | / lazy_static! { [INFO] [stdout] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stdout] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stdout] 13 | | }; [INFO] [stdout] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stdout] 15 | | } [INFO] [stdout] | |_^ [INFO] [stdout] | [INFO] [stdout] = note: `#[warn(deprecated)]` on by default [INFO] [stdout] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred [INFO] [stdout] --> tests/tests.rs:10:1 [INFO] [stdout] | [INFO] [stdout] 10 | / lazy_static! { [INFO] [stdout] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stdout] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stdout] 13 | | }; [INFO] [stdout] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stdout] 15 | | } [INFO] [stdout] | |_^ [INFO] [stdout] | [INFO] [stdout] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred [INFO] [stdout] --> tests/tests.rs:10:1 [INFO] [stdout] | [INFO] [stdout] 10 | / lazy_static! { [INFO] [stdout] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stdout] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stdout] 13 | | }; [INFO] [stdout] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stdout] 15 | | } [INFO] [stdout] | |_^ [INFO] [stdout] | [INFO] [stdout] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] warning: use of deprecated constant `std::sync::ONCE_INIT`: the `new` function is now preferred [INFO] [stdout] --> tests/tests.rs:10:1 [INFO] [stdout] | [INFO] [stdout] 10 | / lazy_static! { [INFO] [stdout] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stdout] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stdout] 13 | | }; [INFO] [stdout] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stdout] 15 | | } [INFO] [stdout] | |_^ [INFO] [stdout] | [INFO] [stdout] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] error[E0283]: type annotations needed for `(SsProbMats, Vec, SsFreeEnergyMats)` [INFO] [stdout] --> tests/tests.rs:20:11 [INFO] [stdout] | [INFO] [stdout] 20 | let _ = get_bpp_and_unpair_prob_mats(&TEST_SEQ[..]); [INFO] [stdout] | - ^^^^^^^^^^^^^^^^^^^^^^^^^^^^ cannot infer type for type parameter `T` declared on the function `get_bpp_and_unpair_prob_mats` [INFO] [stdout] | | [INFO] [stdout] | consider giving this pattern the explicit type `(SsProbMats, Vec, SsFreeEnergyMats)`, where the type parameter `T` is specified [INFO] [stdout] | [INFO] [stdout] ::: /opt/rustwide/workdir/src/mccaskill_algo.rs:80:6 [INFO] [stdout] | [INFO] [stdout] 80 | T: Unsigned + PrimInt + Hash + FromPrimitive + Integer, [INFO] [stdout] | -------- required by this bound in `rna_algos::mccaskill_algo::get_bpp_and_unpair_prob_mats` [INFO] [stdout] | [INFO] [stdout] = note: cannot satisfy `_: Unsigned` [INFO] [stdout] help: consider specifying the type argument in the function call [INFO] [stdout] | [INFO] [stdout] 20 | let _ = get_bpp_and_unpair_prob_mats::(&TEST_SEQ[..]); [INFO] [stdout] | ^^^^^ [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] error: aborting due to previous error; 5 warnings emitted [INFO] [stdout] [INFO] [stdout] [INFO] [stdout] For more information about this error, try `rustc --explain E0283`. [INFO] [stdout] [INFO] [stderr] error: could not compile `rna-algos` [INFO] [stderr] [INFO] [stderr] To learn more, run the command again with --verbose. [INFO] [stderr] warning: build failed, waiting for other jobs to finish... [INFO] [stderr] error: build failed [INFO] running `Command { std: "docker" "inspect" "ce84c04a20931a78619911e812b3b38bda94942b464bfb987876653450ba04c0", kill_on_drop: false }` [INFO] running `Command { std: "docker" "rm" "-f" "ce84c04a20931a78619911e812b3b38bda94942b464bfb987876653450ba04c0", kill_on_drop: false }` [INFO] [stdout] ce84c04a20931a78619911e812b3b38bda94942b464bfb987876653450ba04c0