[INFO] fetching crate rna-algos 0.1.14... [INFO] checking rna-algos-0.1.14 against try#8a749131e7beb72f6edacefd2bdcbed3d67b2112 for pr-72331 [INFO] extracting crate rna-algos 0.1.14 into /workspace/builds/worker-3/source [INFO] validating manifest of crates.io crate rna-algos 0.1.14 on toolchain 8a749131e7beb72f6edacefd2bdcbed3d67b2112 [INFO] running `"/workspace/cargo-home/bin/cargo" "+8a749131e7beb72f6edacefd2bdcbed3d67b2112" "read-manifest" "--manifest-path" "Cargo.toml"` [INFO] started tweaking crates.io crate rna-algos 0.1.14 [INFO] finished tweaking crates.io crate rna-algos 0.1.14 [INFO] tweaked toml for crates.io crate rna-algos 0.1.14 written to /workspace/builds/worker-3/source/Cargo.toml [INFO] crate crates.io crate rna-algos 0.1.14 already has a lockfile, it will not be regenerated [INFO] running `"/workspace/cargo-home/bin/cargo" "+8a749131e7beb72f6edacefd2bdcbed3d67b2112" "fetch" "--locked" "--manifest-path" "Cargo.toml"` [INFO] [stderr] Downloading crates ... [INFO] [stderr] Downloaded rna-ss-params v0.1.16 [INFO] running `"docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-3/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-3/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=0" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+8a749131e7beb72f6edacefd2bdcbed3d67b2112" "check" "--frozen" "--all" "--all-targets"` [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] [stdout] 21eb6d43a89140b1c836f64babb541010c266ac2be8109051dab406e6e73cfc1 [INFO] running `"docker" "start" "-a" "21eb6d43a89140b1c836f64babb541010c266ac2be8109051dab406e6e73cfc1"` [INFO] [stderr] sudo: setrlimit(RLIMIT_CORE): Operation not permitted [INFO] [stderr] Compiling syn v1.0.16 [INFO] [stderr] Compiling serde v1.0.104 [INFO] [stderr] Compiling memchr v2.3.3 [INFO] [stderr] Compiling byteorder v1.3.4 [INFO] [stderr] Compiling libc v0.2.67 [INFO] [stderr] Compiling semver v0.1.20 [INFO] [stderr] Compiling matrixmultiply v0.1.15 [INFO] [stderr] Compiling bv v0.7.4 [INFO] [stderr] Compiling ndarray v0.9.1 [INFO] [stderr] Checking ucd-util v0.1.7 [INFO] [stderr] Checking void v1.0.2 [INFO] [stderr] Checking rawpointer v0.1.0 [INFO] [stderr] Compiling regex v0.2.11 [INFO] [stderr] Checking utf8-ranges v1.0.4 [INFO] [stderr] Checking bit-vec v0.4.4 [INFO] [stderr] Checking lazy_static v0.1.16 [INFO] [stderr] Checking bytecount v0.3.2 [INFO] [stderr] Checking lazy_static v0.2.11 [INFO] [stderr] Checking approx v0.1.1 [INFO] [stderr] Checking custom_derive v0.1.7 [INFO] [stderr] Checking quick-error v1.2.3 [INFO] [stderr] Checking scoped_threadpool v0.1.9 [INFO] [stderr] Compiling num-integer v0.1.42 [INFO] [stderr] Checking thread_local v0.3.6 [INFO] [stderr] Checking itertools v0.6.5 [INFO] [stderr] Checking unreachable v1.0.0 [INFO] [stderr] Checking getopts v0.2.21 [INFO] [stderr] Checking regex-syntax v0.5.6 [INFO] [stderr] Checking bit-set v0.4.0 [INFO] [stderr] Compiling rustc_version v0.1.7 [INFO] [stderr] Checking num-traits v0.1.43 [INFO] [stderr] Checking num-complex v0.1.43 [INFO] [stderr] Checking itertools-num v0.1.3 [INFO] [stderr] Checking ordered-float v0.5.2 [INFO] [stderr] Compiling newtype_derive v0.1.6 [INFO] [stderr] Checking csv-core v0.1.10 [INFO] [stderr] Checking aho-corasick v0.6.10 [INFO] [stderr] Checking regex-automata v0.1.9 [INFO] [stderr] Checking fxhash v0.2.1 [INFO] [stderr] Checking time v0.1.42 [INFO] [stderr] Checking num_cpus v1.12.0 [INFO] [stderr] Checking bio-seq-algos v0.1.15 [INFO] [stderr] Checking rna-ss-params v0.1.16 [INFO] [stderr] Compiling serde_derive v1.0.104 [INFO] [stderr] Checking bstr v0.2.11 [INFO] [stderr] Checking multimap v0.4.0 [INFO] [stderr] Checking vec_map v0.8.1 [INFO] [stderr] Checking csv v1.1.3 [INFO] [stderr] Checking bio v0.20.3 [INFO] [stderr] Checking rna-algos v0.1.14 (/opt/rustwide/workdir) [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:43:1 [INFO] [stderr] | [INFO] [stderr] 43 | / lazy_static! { [INFO] [stderr] 44 | | pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp(); [INFO] [stderr] 45 | | pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp(); [INFO] [stderr] 46 | | pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp(); [INFO] [stderr] ... | [INFO] [stderr] 295 | | }; [INFO] [stderr] 296 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/mccaskill_algo.rs:75:1 [INFO] [stderr] | [INFO] [stderr] 75 | / lazy_static! { [INFO] [stderr] 76 | | pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 77 | | pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp(); [INFO] [stderr] 78 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: 30 warnings emitted [INFO] [stderr] [INFO] [stderr] warning: 30 warnings emitted [INFO] [stderr] [INFO] [stderr] warning: unnecessary braces around block return value [INFO] [stderr] --> tests/tests.rs:14:36 [INFO] [stderr] | [INFO] [stderr] 14 | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] | ^^^^^^^^^^^^^^^^ help: remove these braces [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(unused_braces)]` on by default [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:10:1 [INFO] [stderr] | [INFO] [stderr] 10 | / lazy_static! { [INFO] [stderr] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stderr] 13 | | }; [INFO] [stderr] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 15 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:10:1 [INFO] [stderr] | [INFO] [stderr] 10 | / lazy_static! { [INFO] [stderr] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stderr] 13 | | }; [INFO] [stderr] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 15 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:10:1 [INFO] [stderr] | [INFO] [stderr] 10 | / lazy_static! { [INFO] [stderr] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stderr] 13 | | }; [INFO] [stderr] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 15 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:10:1 [INFO] [stderr] | [INFO] [stderr] 10 | / lazy_static! { [INFO] [stderr] 11 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 12 | | convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()) [INFO] [stderr] 13 | | }; [INFO] [stderr] 14 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 15 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: 5 warnings emitted [INFO] [stderr] [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 49.86s [INFO] running `"docker" "inspect" "21eb6d43a89140b1c836f64babb541010c266ac2be8109051dab406e6e73cfc1"` [INFO] running `"docker" "rm" "-f" "21eb6d43a89140b1c836f64babb541010c266ac2be8109051dab406e6e73cfc1"` [INFO] [stdout] 21eb6d43a89140b1c836f64babb541010c266ac2be8109051dab406e6e73cfc1