[INFO] crate rna-algos 0.1.14 is already in cache
[INFO] checking rna-algos-0.1.14 against master#209b2be09fcaff937480d1fbbe8b31646e361c7a for pr-70917
[INFO] extracting crate rna-algos 0.1.14 into /workspace/builds/worker-8/source
[INFO] validating manifest of crates.io crate rna-algos 0.1.14 on toolchain 209b2be09fcaff937480d1fbbe8b31646e361c7a
[INFO] running `"/workspace/cargo-home/bin/cargo" "+209b2be09fcaff937480d1fbbe8b31646e361c7a" "read-manifest" "--manifest-path" "Cargo.toml"`
[INFO] started tweaking crates.io crate rna-algos 0.1.14
[INFO] finished tweaking crates.io crate rna-algos 0.1.14
[INFO] tweaked toml for crates.io crate rna-algos 0.1.14 written to /workspace/builds/worker-8/source/Cargo.toml
[INFO] crate crates.io crate rna-algos 0.1.14 already has a lockfile, it will not be regenerated
[INFO] running `"/workspace/cargo-home/bin/cargo" "+209b2be09fcaff937480d1fbbe8b31646e361c7a" "fetch" "--locked" "--manifest-path" "Cargo.toml"`
[INFO] [stderr]     Blocking waiting for file lock on package cache
[INFO] [stderr]     Blocking waiting for file lock on package cache
[INFO] running `"docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-8/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=0" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+209b2be09fcaff937480d1fbbe8b31646e361c7a" "check" "--frozen" "--all" "--all-targets"`
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] [stdout] bebd2334952cc44e32e8ac6c6a481b7137d680a79060ea6c993e3b96c01526e9
[INFO] running `"docker" "start" "-a" "bebd2334952cc44e32e8ac6c6a481b7137d680a79060ea6c993e3b96c01526e9"`
[INFO] [stderr]    Compiling ndarray v0.9.1
[INFO] [stderr]    Compiling bv v0.7.4
[INFO] [stderr]     Checking bio-seq-algos v0.1.15
[INFO] [stderr]     Checking ordered-float v0.5.2
[INFO] [stderr]     Checking bstr v0.2.11
[INFO] [stderr]     Checking multimap v0.4.0
[INFO] [stderr]     Checking vec_map v0.8.1
[INFO] [stderr]     Checking rna-ss-params v0.1.16
[INFO] [stderr]     Checking csv v1.1.3
[INFO] [stderr]     Checking bio v0.20.3
[INFO] [stderr]     Checking rna-algos v0.1.14 (/opt/rustwide/workdir)
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: `#[warn(deprecated)]` on by default
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: `#[warn(deprecated)]` on by default
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:43:1
[INFO] [stderr]     |
[INFO] [stderr] 43  | / lazy_static! {
[INFO] [stderr] 44  | |   pub static ref EXP_HELIX_AU_OR_GU_END_PENALTY_DELTA_FE: FreeEnergy = HELIX_AU_OR_GU_END_PENALTY_DELTA_FE.exp();
[INFO] [stderr] 45  | |   pub static ref EXP_MAX_NINIO: FreeEnergy = MAX_NINIO.exp();
[INFO] [stderr] 46  | |   pub static ref EXP_COEFFICIENT_4_NINIO: FreeEnergy = COEFFICIENT_4_NINIO.exp();
[INFO] [stderr] ...   |
[INFO] [stderr] 295 | |   };
[INFO] [stderr] 296 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> src/mccaskill_algo.rs:75:1
[INFO] [stderr]    |
[INFO] [stderr] 75 | / lazy_static! {
[INFO] [stderr] 76 | |   pub static ref EXP_CONST_4_INIT_ML_DELTA_FE: FreeEnergy = CONST_4_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 77 | |   pub static ref EXP_COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE: FreeEnergy = COEFFICIENT_4_TERM_OF_NUM_OF_BRANCHING_HELICES_ON_INIT_ML_DELTA_FE.exp();
[INFO] [stderr] 78 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: unnecessary braces around block return value
[INFO] [stderr]   --> tests/tests.rs:14:36
[INFO] [stderr]    |
[INFO] [stderr] 14 |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr]    |                                    ^^^^^^^^^^^^^^^^ help: remove these braces
[INFO] [stderr]    |
[INFO] [stderr]    = note: `#[warn(unused_braces)]` on by default
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:10:1
[INFO] [stderr]    |
[INFO] [stderr] 10 | / lazy_static! {
[INFO] [stderr] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stderr] 13 | |   };
[INFO] [stderr] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 15 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: `#[warn(deprecated)]` on by default
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:10:1
[INFO] [stderr]    |
[INFO] [stderr] 10 | / lazy_static! {
[INFO] [stderr] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stderr] 13 | |   };
[INFO] [stderr] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 15 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:10:1
[INFO] [stderr]    |
[INFO] [stderr] 10 | / lazy_static! {
[INFO] [stderr] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stderr] 13 | |   };
[INFO] [stderr] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 15 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:10:1
[INFO] [stderr]    |
[INFO] [stderr] 10 | / lazy_static! {
[INFO] [stderr] 11 | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 12 | |     convert(&String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes())
[INFO] [stderr] 13 | |   };
[INFO] [stderr] 14 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 15 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro (in Nightly builds, run with -Z macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr]     Finished dev [unoptimized + debuginfo] target(s) in 18.00s
[INFO] running `"docker" "inspect" "bebd2334952cc44e32e8ac6c6a481b7137d680a79060ea6c993e3b96c01526e9"`
[INFO] running `"docker" "rm" "-f" "bebd2334952cc44e32e8ac6c6a481b7137d680a79060ea6c993e3b96c01526e9"`
[INFO] [stdout] bebd2334952cc44e32e8ac6c6a481b7137d680a79060ea6c993e3b96c01526e9
