[INFO] crate rna-algos 0.1.10 is already in cache [INFO] checking rna-algos-0.1.10 against master#4007d4ef26eab44bdabc2b7574d032152264d3ad for pr-66919 [INFO] extracting crate rna-algos 0.1.10 into /workspace/builds/worker-6/source [INFO] validating manifest of crates.io crate rna-algos 0.1.10 on toolchain 4007d4ef26eab44bdabc2b7574d032152264d3ad [INFO] running `"/workspace/cargo-home/bin/cargo" "+4007d4ef26eab44bdabc2b7574d032152264d3ad" "read-manifest" "--manifest-path" "Cargo.toml"` [INFO] started tweaking crates.io crate rna-algos 0.1.10 [INFO] finished tweaking crates.io crate rna-algos 0.1.10 [INFO] tweaked toml for crates.io crate rna-algos 0.1.10 written to /workspace/builds/worker-6/source/Cargo.toml [INFO] running `"/workspace/cargo-home/bin/cargo" "+4007d4ef26eab44bdabc2b7574d032152264d3ad" "generate-lockfile" "--manifest-path" "Cargo.toml" "-Zno-index-update"` [INFO] running `"/workspace/cargo-home/bin/cargo" "+4007d4ef26eab44bdabc2b7574d032152264d3ad" "fetch" "--locked" "--manifest-path" "Cargo.toml"` [INFO] running `"docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-6/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-6/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=0" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+4007d4ef26eab44bdabc2b7574d032152264d3ad" "check" "--frozen" "--all" "--all-targets"` [INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap. [INFO] [stdout] b7e276620211a0e415c68c8bf94a04525c6f5c43dfe10e80fb47484ff44cd52d [INFO] running `"docker" "start" "-a" "b7e276620211a0e415c68c8bf94a04525c6f5c43dfe10e80fb47484ff44cd52d"` [INFO] [stderr] Compiling bv v0.7.4 [INFO] [stderr] Compiling ndarray v0.9.1 [INFO] [stderr] Checking bio-seq-algos v0.1.12 [INFO] [stderr] Checking itertools-num v0.1.3 [INFO] [stderr] Checking bstr v0.2.8 [INFO] [stderr] Checking vec_map v0.8.1 [INFO] [stderr] Checking multimap v0.4.0 [INFO] [stderr] Checking rna-ss-params v0.1.13 [INFO] [stderr] Checking csv v1.1.1 [INFO] [stderr] Checking bio v0.20.3 [INFO] [stderr] Checking rna-algos v0.1.10 (/opt/rustwide/workdir) [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 21.65s [INFO] running `"docker" "inspect" "b7e276620211a0e415c68c8bf94a04525c6f5c43dfe10e80fb47484ff44cd52d"` [INFO] running `"docker" "rm" "-f" "b7e276620211a0e415c68c8bf94a04525c6f5c43dfe10e80fb47484ff44cd52d"` [INFO] [stdout] b7e276620211a0e415c68c8bf94a04525c6f5c43dfe10e80fb47484ff44cd52d