[INFO] fetching crate rna-algos 0.1.10...
[INFO] checking rna-algos-0.1.10 against try#ea663bba38739867a4b75ac820991b4f5d093c3b for pr-62262-1
[INFO] extracting crate rna-algos 0.1.10 into /workspace/builds/worker-5/source
[INFO] validating manifest of crates.io crate rna-algos 0.1.10 on toolchain ea663bba38739867a4b75ac820991b4f5d093c3b
[INFO] running `"/workspace/cargo-home/bin/cargo" "+ea663bba38739867a4b75ac820991b4f5d093c3b" "read-manifest" "--manifest-path" "Cargo.toml"`
[INFO] started tweaking crates.io crate rna-algos 0.1.10
[INFO] finished tweaking crates.io crate rna-algos 0.1.10
[INFO] tweaked toml for crates.io crate rna-algos 0.1.10 written to /workspace/builds/worker-5/source/Cargo.toml
[INFO] running `"/workspace/cargo-home/bin/cargo" "+ea663bba38739867a4b75ac820991b4f5d093c3b" "generate-lockfile" "--manifest-path" "Cargo.toml" "-Zno-index-update"`
[INFO] running `"/workspace/cargo-home/bin/cargo" "+ea663bba38739867a4b75ac820991b4f5d093c3b" "fetch" "--locked" "--manifest-path" "Cargo.toml"`
[INFO] [stderr]  Downloading crates ...
[INFO] [stderr]   Downloaded rna-ss-params v0.1.13
[INFO] running `"docker" "create" "-v" "/var/lib/crater-agent-workspace/builds/worker-5/target:/opt/rustwide/target:rw,Z" "-v" "/var/lib/crater-agent-workspace/builds/worker-5/source:/opt/rustwide/workdir:ro,Z" "-v" "/var/lib/crater-agent-workspace/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/var/lib/crater-agent-workspace/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=0" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=forbid" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+ea663bba38739867a4b75ac820991b4f5d093c3b" "check" "--frozen" "--all" "--all-targets"`
[INFO] [stderr] WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
[INFO] [stdout] c85f11554fa1a5551722d62eb25edfee4bae8f01f0fb08de1e25d09ef6cd7f80
[INFO] running `"docker" "start" "-a" "c85f11554fa1a5551722d62eb25edfee4bae8f01f0fb08de1e25d09ef6cd7f80"`
[INFO] [stderr]    Compiling bv v0.7.4
[INFO] [stderr]    Compiling ndarray v0.9.1
[INFO] [stderr]     Checking bytecount v0.3.2
[INFO] [stderr]     Checking custom_derive v0.1.7
[INFO] [stderr]     Checking bio-seq-algos v0.1.12
[INFO] [stderr]     Checking bit-set v0.4.0
[INFO] [stderr]    Compiling newtype_derive v0.1.6
[INFO] [stderr]     Checking num-complex v0.1.43
[INFO] [stderr]     Checking itertools-num v0.1.3
[INFO] [stderr]     Checking aho-corasick v0.6.10
[INFO] [stderr]     Checking ordered-float v0.5.2
[INFO] [stderr]     Checking rna-ss-params v0.1.13
[INFO] [stderr]     Checking bstr v0.2.8
[INFO] [stderr]     Checking vec_map v0.8.1
[INFO] [stderr]     Checking multimap v0.4.0
[INFO] [stderr]     Checking regex v0.2.11
[INFO] [stderr]     Checking csv v1.1.1
[INFO] [stderr]     Checking bio v0.20.3
[INFO] [stderr]     Checking rna-algos v0.1.10 (/opt/rustwide/workdir)
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: `#[warn(deprecated)]` on by default
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: `#[warn(deprecated)]` on by default
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]    --> src/utils.rs:36:1
[INFO] [stderr]     |
[INFO] [stderr] 36  | / lazy_static! {
[INFO] [stderr] 37  | |   static ref CANONICAL_BPS: HashMap<BasePair, bool> = {
[INFO] [stderr] 38  | |     [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect()
[INFO] [stderr] 39  | |   };
[INFO] [stderr] ...   |
[INFO] [stderr] 209 | |   };
[INFO] [stderr] 210 | | }
[INFO] [stderr]     | |_^
[INFO] [stderr]     |
[INFO] [stderr]     = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:8:1
[INFO] [stderr]    |
[INFO] [stderr] 8  | / lazy_static! {
[INFO] [stderr] 9  | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 10 | |     String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()
[INFO] [stderr] 11 | |   };
[INFO] [stderr] 12 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 13 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: `#[warn(deprecated)]` on by default
[INFO] [stderr]    = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:8:1
[INFO] [stderr]    |
[INFO] [stderr] 8  | / lazy_static! {
[INFO] [stderr] 9  | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 10 | |     String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()
[INFO] [stderr] 11 | |   };
[INFO] [stderr] 12 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 13 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:8:1
[INFO] [stderr]    |
[INFO] [stderr] 8  | / lazy_static! {
[INFO] [stderr] 9  | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 10 | |     String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()
[INFO] [stderr] 11 | |   };
[INFO] [stderr] 12 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 13 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred
[INFO] [stderr]   --> tests/tests.rs:8:1
[INFO] [stderr]    |
[INFO] [stderr] 8  | / lazy_static! {
[INFO] [stderr] 9  | |   static ref TEST_SEQ: Seq = {
[INFO] [stderr] 10 | |     String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes()
[INFO] [stderr] 11 | |   };
[INFO] [stderr] 12 | |   static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()};
[INFO] [stderr] 13 | | }
[INFO] [stderr]    | |_^
[INFO] [stderr]    |
[INFO] [stderr]    = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info)
[INFO] [stderr] 
[INFO] [stderr]     Finished dev [unoptimized + debuginfo] target(s) in 15.30s
[INFO] running `"docker" "inspect" "c85f11554fa1a5551722d62eb25edfee4bae8f01f0fb08de1e25d09ef6cd7f80"`
[INFO] running `"docker" "rm" "-f" "c85f11554fa1a5551722d62eb25edfee4bae8f01f0fb08de1e25d09ef6cd7f80"`
[INFO] [stdout] c85f11554fa1a5551722d62eb25edfee4bae8f01f0fb08de1e25d09ef6cd7f80