[INFO] crate rna-algos 0.1.10 is already in cache [INFO] testing rna-algos-0.1.10 against 1.38.0 for beta-1.39-1 [INFO] extracting crate rna-algos 0.1.10 into work/builds/worker-10/source [INFO] validating manifest of crates.io crate rna-algos 0.1.10 on toolchain 1.38.0 [INFO] running `"/big/crater/work/cargo-home/bin/cargo" "+1.38.0" "read-manifest" "--manifest-path" "Cargo.toml"` [INFO] started tweaking crates.io crate rna-algos 0.1.10 [INFO] finished tweaking crates.io crate rna-algos 0.1.10 [INFO] tweaked toml for crates.io crate rna-algos 0.1.10 written to work/builds/worker-10/source/Cargo.toml [INFO] running `"/big/crater/work/cargo-home/bin/cargo" "+1.38.0" "generate-lockfile" "--manifest-path" "Cargo.toml" "-Zno-index-update"` [INFO] running `"/big/crater/work/cargo-home/bin/cargo" "+1.38.0" "fetch" "--locked" "--manifest-path" "Cargo.toml"` [INFO] running `"docker" "create" "-v" "/big/crater/work/builds/worker-10/target:/opt/rustwide/target:rw,Z" "-v" "/big/crater/work/builds/worker-10/source:/opt/rustwide/workdir:ro,Z" "-v" "/big/crater/work/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/big/crater/work/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=1000" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=warn" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+1.38.0" "build" "--frozen"` [INFO] [stdout] 96085727fe7b4175cfafdbb924b38b022b5b50fbc3a7e3038dde12aecd48cc49 [INFO] running `"docker" "start" "-a" "96085727fe7b4175cfafdbb924b38b022b5b50fbc3a7e3038dde12aecd48cc49"` [INFO] [stderr] Compiling semver v0.1.20 [INFO] [stderr] Compiling memchr v2.2.1 [INFO] [stderr] Compiling bv v0.7.4 [INFO] [stderr] Compiling ndarray v0.9.1 [INFO] [stderr] Compiling lazy_static v0.1.16 [INFO] [stderr] Compiling bit-vec v0.4.4 [INFO] [stderr] Compiling custom_derive v0.1.7 [INFO] [stderr] Compiling bytecount v0.3.2 [INFO] [stderr] Compiling itertools v0.6.5 [INFO] [stderr] Compiling regex-automata v0.1.8 [INFO] [stderr] Compiling fxhash v0.2.1 [INFO] [stderr] Compiling num-complex v0.1.43 [INFO] [stderr] Compiling itertools-num v0.1.3 [INFO] [stderr] Compiling ordered-float v0.5.2 [INFO] [stderr] Compiling vec_map v0.8.1 [INFO] [stderr] Compiling multimap v0.4.0 [INFO] [stderr] Compiling bio-seq-algos v0.1.12 [INFO] [stderr] Compiling rna-ss-params v0.1.13 [INFO] [stderr] Compiling bit-set v0.4.0 [INFO] [stderr] Compiling rustc_version v0.1.7 [INFO] [stderr] Compiling newtype_derive v0.1.6 [INFO] [stderr] Compiling aho-corasick v0.6.10 [INFO] [stderr] Compiling csv-core v0.1.6 [INFO] [stderr] Compiling bstr v0.2.8 [INFO] [stderr] Compiling regex v0.2.11 [INFO] [stderr] Compiling csv v1.1.1 [INFO] [stderr] Compiling bio v0.20.3 [INFO] [stderr] Compiling rna-algos v0.1.10 (/opt/rustwide/workdir) [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 12.57s [INFO] running `"docker" "inspect" "96085727fe7b4175cfafdbb924b38b022b5b50fbc3a7e3038dde12aecd48cc49"` [INFO] running `"docker" "rm" "-f" "96085727fe7b4175cfafdbb924b38b022b5b50fbc3a7e3038dde12aecd48cc49"` [INFO] [stdout] 96085727fe7b4175cfafdbb924b38b022b5b50fbc3a7e3038dde12aecd48cc49 [INFO] running `"docker" "create" "-v" "/big/crater/work/builds/worker-10/target:/opt/rustwide/target:rw,Z" "-v" "/big/crater/work/builds/worker-10/source:/opt/rustwide/workdir:ro,Z" "-v" "/big/crater/work/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/big/crater/work/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=1000" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=warn" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+1.38.0" "test" "--frozen" "--no-run"` [INFO] [stdout] 99d1d65299223a2f8382fe6f5b500c6aa863c5ab39d7fa9cdb64c99ea4ac4b23 [INFO] running `"docker" "start" "-a" "99d1d65299223a2f8382fe6f5b500c6aa863c5ab39d7fa9cdb64c99ea4ac4b23"` [INFO] [stderr] Compiling rna-algos v0.1.10 (/opt/rustwide/workdir) [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> tests/tests.rs:8:1 [INFO] [stderr] | [INFO] [stderr] 8 | / lazy_static! { [INFO] [stderr] 9 | | static ref TEST_SEQ: Seq = { [INFO] [stderr] 10 | | String::from("AUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCCAUGCAAGGGGGCUUUAACACAUGGGAUCC").into_bytes() [INFO] [stderr] 11 | | }; [INFO] [stderr] 12 | | static ref TEST_SEQ_LEN: usize = {TEST_SEQ.len()}; [INFO] [stderr] 13 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: `#[warn(deprecated)]` on by default [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] warning: use of deprecated item 'std::sync::ONCE_INIT': the `new` function is now preferred [INFO] [stderr] --> src/utils.rs:36:1 [INFO] [stderr] | [INFO] [stderr] 36 | / lazy_static! { [INFO] [stderr] 37 | | static ref CANONICAL_BPS: HashMap = { [INFO] [stderr] 38 | | [(AU, true), (CG, true), (GC, true), (GU, true), (UA, true), (UG, true)].iter().cloned().collect() [INFO] [stderr] 39 | | }; [INFO] [stderr] ... | [INFO] [stderr] 209 | | }; [INFO] [stderr] 210 | | } [INFO] [stderr] | |_^ [INFO] [stderr] | [INFO] [stderr] = note: this warning originates in a macro outside of the current crate (in Nightly builds, run with -Z external-macro-backtrace for more info) [INFO] [stderr] [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 0.60s [INFO] running `"docker" "inspect" "99d1d65299223a2f8382fe6f5b500c6aa863c5ab39d7fa9cdb64c99ea4ac4b23"` [INFO] running `"docker" "rm" "-f" "99d1d65299223a2f8382fe6f5b500c6aa863c5ab39d7fa9cdb64c99ea4ac4b23"` [INFO] [stdout] 99d1d65299223a2f8382fe6f5b500c6aa863c5ab39d7fa9cdb64c99ea4ac4b23 [INFO] running `"docker" "create" "-v" "/big/crater/work/builds/worker-10/target:/opt/rustwide/target:rw,Z" "-v" "/big/crater/work/builds/worker-10/source:/opt/rustwide/workdir:ro,Z" "-v" "/big/crater/work/cargo-home:/opt/rustwide/cargo-home:ro,Z" "-v" "/big/crater/work/rustup-home:/opt/rustwide/rustup-home:ro,Z" "-e" "SOURCE_DIR=/opt/rustwide/workdir" "-e" "MAP_USER_ID=1000" "-e" "CARGO_TARGET_DIR=/opt/rustwide/target" "-e" "CARGO_INCREMENTAL=0" "-e" "RUST_BACKTRACE=full" "-e" "RUSTFLAGS=--cap-lints=warn" "-e" "CARGO_HOME=/opt/rustwide/cargo-home" "-e" "RUSTUP_HOME=/opt/rustwide/rustup-home" "-w" "/opt/rustwide/workdir" "-m" "1610612736" "--network" "none" "rustops/crates-build-env" "/opt/rustwide/cargo-home/bin/cargo" "+1.38.0" "test" "--frozen"` [INFO] [stdout] 8750964306c5ffe85682a1813207f058f43e8fd3faabd540f3cc1458bf4e65ff [INFO] running `"docker" "start" "-a" "8750964306c5ffe85682a1813207f058f43e8fd3faabd540f3cc1458bf4e65ff"` [INFO] [stderr] Finished dev [unoptimized + debuginfo] target(s) in 0.06s [INFO] [stderr] Running /opt/rustwide/target/debug/deps/rna_algos-d9a1cded9d4f3bb7 [INFO] [stdout] [INFO] [stdout] running 0 tests [INFO] [stdout] [INFO] [stdout] test result: ok. 0 passed; 0 failed; 0 ignored; 0 measured; 0 filtered out [INFO] [stdout] [INFO] [stderr] Running /opt/rustwide/target/debug/deps/mccaskill-1533d088c853940a [INFO] [stdout] [INFO] [stdout] running 0 tests [INFO] [stdout] [INFO] [stdout] test result: ok. 0 passed; 0 failed; 0 ignored; 0 measured; 0 filtered out [INFO] [stdout] [INFO] [stderr] Running /opt/rustwide/target/debug/deps/tests-6f9bcbee85afd53c [INFO] [stdout] [INFO] [stdout] running 2 tests [INFO] [stdout] test test_log_ss_ppf_mat ... ok [INFO] [stdout] test test_bpp_and_upp_mats ... ok [INFO] [stdout] [INFO] [stdout] test result: ok. 2 passed; 0 failed; 0 ignored; 0 measured; 0 filtered out [INFO] [stdout] [INFO] [stderr] Doc-tests rna_algos [INFO] [stdout] [INFO] [stdout] running 0 tests [INFO] [stdout] [INFO] [stdout] test result: ok. 0 passed; 0 failed; 0 ignored; 0 measured; 0 filtered out [INFO] [stdout] [INFO] running `"docker" "inspect" "8750964306c5ffe85682a1813207f058f43e8fd3faabd540f3cc1458bf4e65ff"` [INFO] running `"docker" "rm" "-f" "8750964306c5ffe85682a1813207f058f43e8fd3faabd540f3cc1458bf4e65ff"` [INFO] [stdout] 8750964306c5ffe85682a1813207f058f43e8fd3faabd540f3cc1458bf4e65ff